Abstract
Caspases, a family of cysteine proteases, have been recognized as the central executors of programmed cell death. Nonetheless, the information on the caspase family has been limited to mammals, Drosophila, and nematodes. To examine the structure and characterization of the Xenopus caspase family, we have cloned the cDNAs encoding caspase-2 and -6-10 in addition to caspase-1 and -3, which we characterized previously (Yaoita, Y., and Nakajima, K. (1997) J. Biol. Chem. 272, 5122-5127). First, the existence of these caspases in frog suggests that the caspase cascades clarified in mammals are conserved at least from Amphibia. Interestingly, Xenopus caspase-1, -8, and -10 (especially caspase-8) showed a lower degree of identity to human equivalents than the other caspases. Second, mRNAs of many caspases increased during the climax of metamorphosis in regressing organs, tail, and intestine, where programmed cell death occurs, but not in apoptotic tail-derived cultured cells (XLT-15-11) treated with thyroid hormone, showing that new RNA synthesis of caspases is dispensable to programmed cell death. Third, comparison of human and Xenopus caspase sequences implies that some proposed regulations of human caspases are not conserved in frog.
Highlights
Caspases, a family of cysteine proteases, have been recognized as the central executors of programmed cell death
Cloning of Xenopus Caspase Genes—To investigate whether Amphibia shares the same set of caspases with human, we have cloned Xenopus caspase genes by polymerase chain reaction (PCR) using DNA primers designed from conserved amino acid sequences
Numerous lines of evidence have established that caspases play a central role in apoptosis and that this cell death pathway has been conserved throughout the evolution of eukaryotes
Summary
Cloning of Xenopus Caspase Genes—A directionally oriented cDNA library of stage 62 tadpole tail was constructed using the Directional Cloning Toolbox and the Time Saver cDNA synthesis kit (Amersham Pharmacia Biotech) with the ZAP Express vector (Stratagene) according to the manufacturer’s instructions. A Xenopus caspase-2 cDNA fragment was amplified from cDNA of stage 62 tadpole tail using the 5Ј-primer (CA(G/A)AA(T/C)AA(G/A)CC(G/A/T/C)AA(G/ A)ATGTT(T/C)TT(T/C)AT(A/T/C)CA) and the 3Ј-primer (TG(G/A)AA(T/ C)TCIGTICCIGGIGC(G/A)TAICC(T/C)TC), which encode peptides QNKPKMFFIQ and EGYAPGTEFH, respectively These PCR products were cloned, sequenced, and identified as Xenopus caspase-9, -8, and -2 genes. The fragments of Xenopus caspase-8 cDNA were amplified by PCR from nine pools of phage obtained as positive clones after the first screening of cDNA libraries using caspase-8 primers (GGCTGTGACGGAGAAGAG and GGTCTTGATTTGTGTAAGTTG), which are located ϳ300 base pairs away on both sides of the pentapeptide-encoding region. The full-length construct of Xenopus caspase-8 was obtained by PCR amplification from cDNA of stage 62 tail using primers GGGAATTCGCAACATGAGTGACCTG and GGATGCATGGTTACATGGCATTAGGA, which contain the initiation and termination codons, respectively, of the Xenopus caspase-8 cDNA phage clone encoding QAFQG. Affinity Labeling of Active Caspases—Affinity labeling was performed as described previously [20]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
