Structure and organization of a cluster of sic tRNA genes in the space between tandem ribosomal RNA gene sets in Bacillus subtilis.

E F Wawrousek,J N Hansen

doi:10.1016/s0021-9258(18)33255-1

Abstract

Hybridization of Southern blots of EcoRI digests of total Bacillus subtilis DNA with ribosomal RNA and transfer RNA probes provides evidence of highly clustered tRNA and rRNA genes, with several tRNA clusters being located in spaces which span between tandem ribosomal RNA gene sets. Clones containing these tRNA clusters were isolated from a Charon 4A library. One of them, denoted trrnB, was partially sequenced. A cluster of six tRNA genes was found, with anticodon assignments of Asn, Thr, Gly, Arg, Pro, Ala. This cluster is closely flanked on both sides by ribosomal RNA gene sets, which were identified by sequencing upward through the 5 S rRNA gene, across a space, and into the 23 S rRNA gene, and also sequencing downward into the 16 S rRNA gene. The tRNA gene cluster appears to be organized into at least two transcriptional units separated by an attenuator region. These transcriptional units may be components of the flanking ribosomal RNA operons. The putative promoter region of the downstream 16 S rRNA is organized differently from Escherichia coli; it is smaller and seems less complex. This gene organization provides insight into possible mechanisms for coordinate and differential control of transfer and ribosomal RNA gene expression.

Highlights

Transfer RNA probes provides evidence of highly dus- We have carried out additional restriction mapping of the tered tRNA and rRNA genes, with several tRNA clus- B. subtilis ribosomal and transfer RNA genes
Theputative promoter region analysis of Southern blots using various ribosomal RNA and transfer RNA probes suggests that the tRNA genes are encoded in the B. subtilis chromosome as only a few tight clusters, some of which are located on inter-operon spaces which span between tandemly arranged ribosomal gene sets
We have determined the nucleotide sequence of the ends to confiim that it spans across the space from an EcoRI restriction site within the 23 S rRNA structural gene in an upstream gene set to an EcoRI restriction site of the 16 S

Summary

MATERIALS AND METHODS

Reagents-[y-“P]ATP (specificactivity, 3000 Ci/mmol) was purchased as a stabilized aqueous solution from Amersham. Restriction of a 2-pg amount of the plasmid with EcoRI and electrophoresis on an agarose gel showed the plasmid to be essentially free of RNA and chromosomal DNA This procedure was readily scaled up to 5 liters of cells to yield about 5 mg of DNA. The pellet was dissolved in 0.5 ml of ice-cold 1X TBE, followed by addition of 0.1 ml of a sodium dodecyl sulfate-containing dye mixture (50% glycerol, 0.4% bromphenol blue, 0.4% xylene cyanol, 1%sodium dodecyl sulfate); a 0.03-ml portion of this was loaded into each well of a 10 well preparative 5% disulfide cross-linked polyacrylamide gel [9].The gel was electrophoresed at 5 mA constant current for 16 h, stained in ethidium bromide (0.5 pg/ml) to visualize the bands on a U.V. transilluminator with a 300-nm filter (U.V. Products). Radiographed at -20 "C against Kodak XAR-5 x-ray film, using a Dupont Cronex Lighting Plus intensifying screen

RESULTS

16 S GTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCG

DISCUSSION