Abstract
cDNA clones of rat peroxisomal 3-ketoacyl-CoA thiolase were isolated. By blotting analysis using the cDNAs as probes, the mRNA for this enzyme was estimated to be about 1.9-kilobase pairs. Elevation of mRNA levels in the liver with administration of di(2-ethylhexyl)phthalate was also evident. Sequencing analysis revealed 1,272 bases of the open reading frame which encoded 424 amino acid residues. Amino acid sequence data on six tryptic peptides and the amino terminus of the purified enzyme confirmed the cDNA sequence. The precursor of peroxisomal thiolase contains at its amino terminus a peptide extension of 26 residues. The mature enzyme is composed of 398 amino acids and the molecular weight is 41,074. The presequence has a net positive charge, lacks a long stretch of hydrophobic residues, and contains a cluster of serine residues. When the primary structure of the precursor was compared to structure of known peroxisomal proteins, there was no common homologous sequence. Peroxisomal thiolase exhibits a significant sequence homology with the mitochondrial thiolase. Possible location of the transport signal of the peroxisomal thiolase is discussed. Acyl-CoA binding sites were also located on primary structures of the two thiolases. The occurrence of interrupting sequences in several clones likely originates from intron sequences.
Highlights
CDNA clones of rat peroxisomal 3-ketoacyl-CoA oxidation system, acyl-CoA oxidase (EC 1.3.3.6) and enoylthiolase were isolated
All the peroxisomal proteins heretofore reported are synthesized on freepolysomes (7) and most of theirprimary translation products have the same molecular weights as the mature forms
Only sequence homology with the mitochondrial thiolase. thiolaseissynthesized as alarger precursor form and is Possible location of the transport signal of the peroxi- converted to its maturfeorm by proteolytic processing (9-11)
Summary
Polipidemic compounds (e.g. clofibrate (4) and DEHP(’3)) in parallel with the other twoenzymes of the peroxisomal p-. That the from the Sau3AI site to thepoly(A) addition site is 526bases composite cDNA sequence constructed by the above clones (see below) These data suggest that mRNA for peroxisomal had a single open reading frame for peroxisomal thiolase, but thiolase contains a poly(A) tail with an average length of was interrupted by an untranslatable sequence in its central nearly 300 nucleotides. CDNAs. In the firstexperiment,a HpaIIIPstI fragment of The above results suggest that thecDNA inserts of pMJ203, pMJ206 was used as a primer(Fig. L A , primer I), and a HhaI/ pMJ227, and pMJ234, when overlapping, cover the full length HhaI fragment of pMJ204 was used as a hybridization probe of the mRNA sequence for the enzyme. CgggdlldtCaggagCtgCtgCtgdgtCt999.919Cttcgggtgcgccttt=cct=c=tggggaatctta9ctgtcac tcagagctccatcagggccacaaagggctgtgtggttgcattg~~ttt~tgagttagcc~a9ccc~99g~ctg99a99a~a bt 1 ATCGAT CGG CTG CAG GTA GTG CTG GGC CAC CTG GGCCGGCG
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
