Abstract

Sodium transport regulation in the kidney collecting duct cells in mice with the Agouti yellow (Ay) mutation

Highlights

  • Effects of mutation Agouti yellow (Aу) linked with melanocortin type of obesity in mice on mineralocorticoid regulation mechanism and non-genomic effect of aldosterone on sodium transport were studied

  • Study of expression of epithelial sodium channel alfasubunit (ENaC) that takes a part in sodium transport in principal cells of collecting ducts (CCD) have shown decreased mRNA contents of these protein in mice C57BL/6j-Aу/a

  • In C57BL/6j-Aу/a mice, there was no decrease in the permeability of the CCD cell plasma membrane for sodium ions

Read more

Summary

Регуляция транспорта натрия в клетках собирательных трубок почки

Регуляция транспорта натрия в клетках собирательных трубок почки мышей с мутацией Agouti yellow (Ау). Аннотация: Исследовали механизм минералокортикоидной регуляции и негеномный эффект альдостерона на транспорт натрия в главных клетках собирательных трубок кортикального отдела почек мышей с мутацией Agouti yellow (Аy), связанной с ожирением меланокортинового типа. Определение концентрации альдостерона в плазме крови, а также содержания мРНК минералокортикоидного рецептора и альфа субъединицы Na,K-АТФазы в клетках собирательных трубок кортикального отдела почек не выявило отличий у мышей линии C57BL/6j-Ay/a от уровня в конгенной линии C57BL/6j. У мышей C57BL/6j-Ay/a не обнаружено снижения проницаемости плазматической мембраны клеток собирательных трубок кортикального отдела почек для ионов натрия при остром воздействии альдостерона (10 нM), в отличие от мышей конгенной линии C57BL/6j. Sodium transport regulation in the kidney collecting duct cells in mice with the Agouti yellow (Ay) mutation

Материалы и методы
CCCAGCTTCTTTGACTTTCG αENaC
Результаты и обсуждение

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.