Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

Martin Hennenberg,Claudius Füllhase,Christian G Stief,Christer Beckmann,Frank Strittmatter,Christian Gratzke,Beata Rutz,Francesco Montorsi,Raphaela Waidelich,Petter Hedlund,Karl-Erik Andersson,Karl X Chai

doi:10.1371/journal.pone.0050904

Abstract

BackgroundThe transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.ObjectiveTo examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.MethodsProstate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).ResultsImmunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.ConclusionsSilodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

Highlights

Male lower urinary tract symptoms (LUTS) can be caused by benign prostate enlargement (BPE) and consequent benign prostate obstruction (BPO) [1,2,3]
Immunoreactivity for Elk1, serum response factor (SRF), and myocardin was observed in stromal cells of tissues from each patient
SRF colocalized with myocardin and a-smooth muscle actin

Summary

Introduction

Male lower urinary tract symptoms (LUTS) can be caused by benign prostate enlargement (BPE) and consequent benign prostate obstruction (BPO) [1,2,3]. Prostate enlargement and smooth muscle tone have for decades been regarded as separate factors contributing to LUTS in patients with BPO (‘‘static’’ and ‘‘dynamic’’ component of obstruction) [2,4], and medical treatment of LUTS is directed at both components. In smooth muscle cells outside the lower urinary tract, Elk and SRF are critically involved in cell cycle and growth [7,8,9,10,11]. A1-ARs, together with other factors, have been proposed to be involved in prostate growth, a regulation of Elk or SRF by these receptors has, to the best of our knowledge, not been considered to date. Activation of Elk and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs

Methods

Results

Conclusion