Abstract
Serum deprivation (SD) is well known to induce G0/G1 cell cycle arrest and apoptosis in various cells. In the present study, we firstly found that SD could induce G1 arrest and the differentiation of human osteoblastic MG-63 cells, as evidenced by the increase of osteoblastic differentiation markers, such as bone morphogenetic protein-2 (BMP-2), osteocalcin and runt-related transcription factor 2 (Runx2). In parallel, gene expression of human GM3 synthase (hST3Gal V) catalyzing ganglioside GM3 biosynthesis was upregulated by SD in MG-63 cells. The 5′-flanking region of the hST3Gal V gene was functionally characterized to elucidate transcriptional regulation of hST3Gal V in SD-induced MG-63 cells. Promoter analysis using 5′-deletion constructs of the hST3Gal V gene demonstrated that the −432 to −177 region functions as the SD-inducible promoter. Site-directed mutagenesis revealed that the Runx2 binding sites located side-by-side at positions −232 and −222 are essential for the SD-induced expression of hST3Gal V in MG-63 cells. In addition, the chromatin immunoprecipitation assay also showed that Runx2 specifically binds to the hST3Gal V promoter region containing Runx2 binding sites. These results suggest that SD triggers upregulation of hST3Gal V gene expression through Runx2 activation by BMP signaling in MG-63 cells.
Highlights
Serum deprivation (SD) has been widely used to produce a synchronized culture by cell cycle arrest in the G0/G1 phase [1,2,3,4,5]
We have demonstrated for the first time that hST3Gal V expression was upregulated during osteoblast differentiation induced by SD, and two potential Runx2-binding sites at positions232 and222 in the hST3Gal V gene play a critical role in transcriptional activation of hST3Gal V at the time
Given that G1 arrest of the cell cycle precedes the differentiation of most mammalian cells [29] and cellular differentiation requires the coordination of G1 cell cycle arrest and cell-specific gene expression [40], our results suggest that SD induced osteoblastic differentiation in MG-63 cells
Summary
Serum deprivation (SD) has been widely used to produce a synchronized culture by cell cycle arrest in the G0/G1 phase [1,2,3,4,5]. TThheessee DDNNAA sseeqquueenncceess,, AACCCCGGCCAACCCCGGCCAA,, cclloosseellyy mmaattcchh tthhee ccoonnsseennssuuss RRuunnxx bbiinnddiinngg motif, 5′-PuACCPuCA-3′ [31] To clarify whether these binding sites are closely associated with SD-induced expression of hST3Gal V in MG-63 cells, one mutant plasmid (pGL3-432muRunx2) was constructed (Figure 6B) and transfected into MG-63 cells, and luciferase assays were performed. Given that the BMP signal cascade starts out with the activation of Smad 1/5/8 by phosphorylation, followed by the complex formation with Smad 4 and translocation into the nucleus where, they trigger the expression of target genes, including Runx2 [43,44], further study is required to clarify the functionality of Runx by interaction with the activated Smad proteins leading to a transcriptional upregulation of hST3Gal in SD-induced MG-63 cells
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
