Sequencing analysis of FUT1 and FUT2 gene in H-deficient phenotype individuals

Abstract

Objective To explore genotyping and sequences of FUT1 and FUT2 gene in H-deficient phenotype individuals. Methods From 2005 to 2014, 13 individuals who were detected H-deficient phenotype in Shenzhen Blood Center were included in this study. Peripheral blood samples were routinely subjected to the ABO, H, and Lewis blood group typing by agglutination tests. The adsorption-elution test was determined for trace amounts of ABH antigens. ABH antigens were detected in saliva samples by saliva agglutination inhibition test. 13 DNA samples were studied by polymerase chain reaction-sequence specific primer (PCR-SSP), DNA sequencing and cloning sequencing methods, and then sequencing analysis of FUT1 and FUT2 allele. Results There were 10 H-deficient secretor phenotype, 2 H-partially deficient secretor phenotype, and 1 H-deficient non-secretor phenotype in these 13 H-deficient individuals. The FUT1 genotypes of 13 H-deficient phenotype individuals were h547-552delAG/h547-552delAG in 3 individuals, h880-882delAG/h547-552delAG in 4 individuals, h880-882delTT/h880-882delTT in 2 individuals, h328G>A/h360-400delGGTATTCCGCATCACCCTGCCCGTGCTGGCCCC in 1 individual, h328G>A/h880-882delTT in 1 individual, h35C>T/h328G>A; 658C>T in 1 individual, h658C>T/h658C>T in 1 individual. The FUT2 genotypes of 13 H-deficient phenotype individuals were Se357 Se357 in 4 individuals, Se357se357, 385 as wild-type gene in 7 individuals, Se357, 716Se357, 716 in 1 individual, se357, 385se357, 385 in 1 individual. Conclusion Point mutation and deletion of FUT1 and FUT2 gene are the molecular basis of H-deficient phenotype. Key words: Phenotype; Fucosyltransferase; China; Population; FUT1 gene; FUT2 gene