Separation of G structures formed by a 27-mer guanosine-rich oligodeoxyribonucleotide by dye–ligand affinity chromatography

Abstract

G-DNA structures, formed by a 27-mer guanosine-rich oligodeoxyribonucleotide, AACCCGGCGTTCGGGGGGTACCGGGTT, were isolated and studied by dye–ligand affinity chromatography, using a Reactive Green 19–agarose resin (RG19–aga) and gel electrophoresis. The experiments were performed in the presence of Li +, Na + and K +, which are able to stabilise the G structures to different extents. Desalting procedures followed by affinity chromatography, performed in the presence of Li +, gave us information on the relationships among the species isolated and their stability. The results show that the more stable species were those obtained in the presence of K +, while in the presence of Li +, the formation of G structures was negligible and the oligonucleotide was almost exclusively present as a stem–loop structure recognised by the RG19–aga affinity resin. Electrophoretic and denaturation and renaturation experiments supported the affinity chromatography results.