Abstract
The beta-heregulin sensory and motor neuron-derived factor (SMDF) has been suggested to be an important regulator of Schwann cell development and proliferation. In the present study, human SMDF was expressed in cultured cell lines. The cells and the recombinant protein were used to examine the membrane association and biological activity of the growth factor. Transfection of cells with SMDF cDNA constructs bearing FLAG epitope tags at either the amino- or carboxyl-terminal ends of the polypeptide resulted in expression of anti-FLAG immunoreactive polypeptides of approximately 44 and 83 kDa. The 83-kDa polypeptide was the major form expressed on the cell surface, as demonstrated by sensitivity to proteolysis in intact cells and surface biotinylation. SMDF was tightly associated with membranes isolated from transfected cells but was solubilized by Triton X-100. Immunofluorescent staining and immunoprecipitation experiments using cells expressing amino- or carboxyl-terminal tagged SMDF revealed that only the carboxyl-terminal end of the protein is exposed on the cell surface. Membranes from SMDF-transfected cells stimulated tyrosine phosphorylation of the beta-heregulin receptor ErbB3 in Schwann cells. Conditioned medium from transfected cells contained a similar activity, suggesting that SMDF is subject to proteolytic release from the plasma membrane. In contrast with other beta-heregulin isoforms, SMDF failed to bind heparin. Stimulation of Schwann cell ErbB3 receptor phosphorylation by SMDF was not affected by inhibition of Schwann cell heparan sulfate proteoglycan synthesis. These results demonstrate that SMDF is a type II transmembrane protein. This orientation places the active epidermal growth factor homology domain, which is located near the carboxyl-terminal end of the polypeptide, on the cell surface, where it can function as a membrane-anchored growth factor.
Highlights
Anism, in which the Schwann cell mitogen is immobilized on the axonal surface, ensures proper matching of Schwann cell numbers and axons during development
An apparently identical 83kDa product was seen in cells transfected with NT-sensory and motor neuron-derived factor (SMDF) or CT-SMDF or SMDF lacking an epitope tag
Experiments with a synthetic -heregulin epidermal growth factor (EGF) homology domain peptide revealed that Schwann cells express functional ErbB2 and ErbB3 receptors, but not ErbB4.2 As shown in Fig. 6A, membranes purified from cells that were stably transfected with SMDF stimulated tyrosine phosphorylation of ErbB3
Summary
CTTCTGGAGGTGAGCCGATG AAGCAGCACCAACTGAGCAT peptide, but contains an internal hydrophobic sequence that could serve as a membrane insertion site [13]. In SMDF, as well as some other heregulin isoforms, the EGF homology domain of SMDF is positioned near the carboxyl-terminal end of the polypeptide. Several heregulins have been shown to bind to heparin and heparan sulfate (10, 16 –18). Binding of some growth factors, such as basic fibroblast growth factor, to cell surface heparan sulfate molecules has been shown to have important consequences for the activities of the factors [19, 20]. The data presented demonstrate that SMDF is a cell surface transmembrane protein that is oriented in the plasma membrane with the carboxyl-terminal EGF homology domain exposed to the extracellular compartment. In contrast with some heregulin isoforms, SMDF does not bind heparin, and its activity is not dependent on Schwann cell heparan sulfate molecules
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
