Selective Inhibition of Endoplasmic Reticulum-associated Degradation Rescues ΔF508-Cystic Fibrosis Transmembrane Regulator and Suppresses Interleukin-8 Levels: THERAPEUTIC IMPLICATIONS

Abstract

Endoplasmic reticulum (ER)-associated degradation (ERAD) is the major quality control pathway of the cell. The most common disease-causing protein folding mutation, ΔF508-cystic fibrosis transmembrane regulator (CFTR), is destroyed by ERAD to cause cystic fibrosis (CF). p97/valosin-containing protein (VCP) physically interacts with gp78/autocrine motility factor receptor to couple ubiquitination, retrotranslocation, and proteasome degradation of misfolded proteins. We show here that p97/VCP and gp78 form complexes with CFTR during translocation from the ER for degradation by the cytosolic proteasome. Interference in the VCP-CFTR complex promoted accumulation of immature CFTR in the ER and partial rescue of functional chloride channels to the cell surface. Moreover, under these conditions, interleukin-8 (IL8), the expression of which is regulated by the proteasome, was reduced. Inhibition of the proteasome with bortezomib (PS-341/Velcade) also rescued CFTR, but with less efficiency, and suppressed NFκB-mediated IL8 activation. The inhibition of the major stress-inducible transcription factor CHOP (CCAAT/enhancer-binding protein homologous protein)/GADD153 together with bortezomib was most effective in repressing NFκB-mediated IL8 activation compared with interference of VCP, MLN-273 (proteasome inhibitor), or 4-phenylbutyrate (histone deacetylase inhibitor). Immunoprecipitation of ΔF508-CFTR from primary CF bronchial epithelial cells confirmed the interaction with VCP and associated chaperones in CF. We conclude that VCP is an integral component of ERAD and cellular stress pathways induced by the unfolded protein response and may be central to the efficacy of CF drugs that target the ubiquitin-proteasome pathway. Endoplasmic reticulum (ER)-associated degradation (ERAD) is the major quality control pathway of the cell. The most common disease-causing protein folding mutation, ΔF508-cystic fibrosis transmembrane regulator (CFTR), is destroyed by ERAD to cause cystic fibrosis (CF). p97/valosin-containing protein (VCP) physically interacts with gp78/autocrine motility factor receptor to couple ubiquitination, retrotranslocation, and proteasome degradation of misfolded proteins. We show here that p97/VCP and gp78 form complexes with CFTR during translocation from the ER for degradation by the cytosolic proteasome. Interference in the VCP-CFTR complex promoted accumulation of immature CFTR in the ER and partial rescue of functional chloride channels to the cell surface. Moreover, under these conditions, interleukin-8 (IL8), the expression of which is regulated by the proteasome, was reduced. Inhibition of the proteasome with bortezomib (PS-341/Velcade) also rescued CFTR, but with less efficiency, and suppressed NFκB-mediated IL8 activation. The inhibition of the major stress-inducible transcription factor CHOP (CCAAT/enhancer-binding protein homologous protein)/GADD153 together with bortezomib was most effective in repressing NFκB-mediated IL8 activation compared with interference of VCP, MLN-273 (proteasome inhibitor), or 4-phenylbutyrate (histone deacetylase inhibitor). Immunoprecipitation of ΔF508-CFTR from primary CF bronchial epithelial cells confirmed the interaction with VCP and associated chaperones in CF. We conclude that VCP is an integral component of ERAD and cellular stress pathways induced by the unfolded protein response and may be central to the efficacy of CF drugs that target the ubiquitin-proteasome pathway. Endoplasmic reticulum (ER) 2The abbreviations used are: ER, endoplasmic reticulum; ERAD, endoplasmic reticulumassociated protein degradation; CFTR, cystic fibrosis transmembrane regulator; VCP, valosin-containing protein; IL, interleukin; CF, cystic fibrosis; BAL, bronchoalveolar lavage; 4-PBA, 4-phenylbutyrate; wt, wild-type; GFP, green fluorescent protein; shRNA, short hairpin RNA; CFTE, cystic fibrosis tracheal epithelial; MQAE, N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide; UPR, unfolded protein response; UPS, ubiquitin-proteasome system. -associated protein degradation (ERAD) eliminates misfolded, damaged, or mutant proteins with abnormal conformation (1Rock K.L. Goldberg A.L. Annu. Rev. Immunol. 1999; 17: 739-779Crossref PubMed Scopus (786) Google Scholar). ERAD targets are selected by a quality control system within the ER lumen and are ultimately destroyed by the cytoplasmic ubiquitin-proteasome system. The ubiquitin-proteasome system plays a pivotal role in cell homeostasis and is vital in regulating various cellular processes. In normal cells, nearly all proteins are continuously degraded and replaced by de novo synthesis. The spatial separation between substrate selection and degradation in ERAD requires substrate transport from the ER to the cytoplasm by a process termed dislocation, recently reviewed by Meusser et al. (2Meusser B. Hirsch C. Jarosch E. Sommer T. Nat. Cell Biol. 2005; 7: 766-772Crossref PubMed Scopus (1004) Google Scholar). The most common disease-causing protein folding mutation is deletion of phenylalanine at position 508 of the cystic fibrosis transmembrane regulator (ΔF508-CFTR), which results in a temperature-sensitive folding defect and premature degradation by ERAD (3Ward C.L. Omura S. Kopito R.R. Cell. 1995; 83: 121-127Abstract Full Text PDF PubMed Scopus (1131) Google Scholar). The absence of CFTR at the airway epithelial cell surface disrupts luminal hydration and is associated with an exaggerated immune response (4Rowe S.M. Miller S. Sorscher E.J. N. Engl. J. Med. 2005; 352: 1992-2001Crossref PubMed Scopus (788) Google Scholar). Functional CFTR can be restored by growth at lower temperature (25-27 °C) or incubation with chemical chaperones, which rescues ΔF508-CFTR from ERAD (5Denning G.M. Anderson M.P. Amara J.F. Marshall J. Smith A.E. Welsh M.J. Nature. 1992; 358: 761-764Crossref PubMed Scopus (1061) Google Scholar). Mammalian p97/valosin-containing protein (VCP) and its yeast counterpart, Cdc48, participate in retrotranslocation of misfolded proteins from the ER for degradation by the cytosolic proteasomes (6Wang Q. Song C. Li C.C. J. Struct. Biol. 2004; 146: 44-57Crossref PubMed Scopus (256) Google Scholar). p97/VCP and its cofactors (Ufd1, Npl4, and p47) interact with misfolded ubiquitinated substrates to dislodge them from the ER to the cytosol for proteasome degradation (7Ye Y. Meyer H.H. Rapoport T.A. J. Cell Biol. 2003; 162: 71-84Crossref PubMed Scopus (501) Google Scholar). We have reported recently that p97/VCP physically interacts with gp78 to couple ubiquitination, retro translocation, and proteasome degradation (8Zhong X. Shen Y. Ballar P. Apostolou A. Agami R. Fang S. J. Biol. Chem. 2004; 279: 45676-45684Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). Originally identified as the tumor autocrine motility factor receptor, gp78 is a multimembrane-spanning protein with RING finger-type ubiquitin-protein ligase activity exposed to the cytoplasmic ER surface. gp78/autocrine motility factor receptor is thus distinguished from CHIP (C terminus of Hsc70-interacting protein) and Parkin ubiquitin-protein ligases and closely resembles the yeast ERAD ubiquitin-protein isopeptide ligase Hrd1p/Der3p. In yeast, Hrd1p/Der3p and Cdc48 are required for CFTR degradation (9Gnann A. Riordan J.R. Wolf D.H. Mol. Biol. Cell. 2004; 15: 4125-4135Crossref PubMed Scopus (79) Google Scholar). We hypothesize that selective inhibition of ERAD not only rescues ΔF508-CFTR, but also suppresses interleukin (IL)-8 levels, the major inflammatory cytokine in cystic fibrosis (CF) airways. Human Subjects—CF (homozygous for ΔF508-CFTR; n = 3, 7-9 years old) and non-CF (n = 3, 8-17 years old) subjects who were undergoing fiberoptic bronchoscopy and bronchoalveolar lavage (BAL) for a clinical indication were invited to participate in a Johns Hopkins Institutional Review Board- and General Clinical Research Center-approved protocol. All three children with CF were chronically infected with one or more bacteria. The non-CF subjects were children with airway pathology: 1) a case of focal bronchiectasis from an earlier Mycoplasma pneumoniae infection (the BAL fluid was culture-positive for Branhamella catarrhalis, and the cytopathology contained neutrophils and lipid-laden macrophages); 2) a case of chronic lung disease and yellow nail syndrome (culture-positive for Hemophilus influenza and associated with neutrophils and lipid-laden macrophages upon BAL); and 3) a case of psychogenic cough (culture-negative and associated with lipid-laden macrophages upon BAL). Except for the case of psychogenic cough, there was a mild inflammatory phenotype. Parents signed informed consent on behalf of their children. Bronchial brushings were obtained after BAL to minimize contamination with mucus and neutrophils. Brushes were directly immersed in cell culture medium on ice for later transport to the laboratory. Investigational Therapeutics—The proteasome inhibitors bortezomib or PS-341 or Velcade (Johns Hopkins Pharmacy) and MLN-273 (under a material transfer agreement) were from Millenium Pharmaceuticals, Inc. (Cambridge, MA), and 4-phenylbutyrate (4-PBA) was from Sigma. Antibodies and Plasmids—Rabbit anti-CFTR 169 and anti-gp78 polyclonal antibodies have been described previously (8Zhong X. Shen Y. Ballar P. Apostolou A. Agami R. Fang S. J. Biol. Chem. 2004; 279: 45676-45684Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 10Lim M. McKenzie K. Floyd A.D. Kwon E. Zeitlin P.L. Am. J. Respir. Cell Mol. Biol. 2004; 31: 351-357Crossref PubMed Scopus (66) Google Scholar). Mouse/rabbit anti-VCP polyclonal antibodies from Affinity BioReagents (Golden, CO) and Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) were used. Anti-Hsp90 (rat monoclonal), anti-Hsp70 (mouse monoclonal/rabbit polyclonal), anti-Hsc70 (rabbit polyclonal), and anti-Hsp40 (rabbit polyclonal) antibodies were purchased from Stressgen Biotechnologies Corp. (San Diego, CA). Rabbit anti-CHIP polyclonal antibody was obtained from Abcam Inc. (Cambridge, MA). The plasmid constructs pCIneo-gp78, pCIneo-gp78C, and VCPQQ have been described previously (8Zhong X. Shen Y. Ballar P. Apostolou A. Agami R. Fang S. J. Biol. Chem. 2004; 279: 45676-45684Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). ΔF508-CFTR-green fluorescent protein (GFP) and wild-type (wt) CFTR-GFP were constructed in the pS65T-C1 vector. VCP short hairpin RNA (shRNA) was constructed in the pSM2 vector (Open Biosystems, Huntsville, AL). Briefly, the single oligonucleotide containing the hairpin and common 5′- and 3′-ends was used as a PCR template. The oligonucleotide was PCR-amplified using universal primers containing XhoI (5′) and EcoRI (3′) sites. The PCR fragment was then cloned into the hairpin cloning site of pSM2. The VCP anti-sense/target sequence 22-mer is shown in boldface, and common microRNA-30 context regions are shown in italics below. The VCP shRNA was amplified using the Advantage-GC PCR kit (Qiagen Inc.) with a single-strand 97-nucleotide “microRNA-30-like” DNA template oligonucleotide (TGCTGTTGACAGTGAGCGCCCGCAAGAAGATGGATCTCATTAGTGAAGCCACAGATGTAATGAGATCCATCTTCTTGCGGATGCCTACTGCCTCGGA) and primers 5′-miR30PCRXhoIF (CAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG) and 3′-miR30PCREcoRIF (CTAAAGTAGCCCCTTGAATTCCGAGGCAGTAGGCA). PCR conditions were as follows: 94 °C for 30 s, 94 °C for 30 s, and 55 °C for 30 s for 25 cycles; 75 °C for 10 min; and 4 °C forever). The CHOP (CCAAT/enhancer-binding protein homologous protein) shRNA was purchased from Open Biosystems. Cell Culture, Transfection, and Metabolic Labeling—IB3-1 cells (ΔF508/W1282X, low level expression of ΔF508-CFTR and no W1282X-CFTR protein), CF tracheal epithelial (CFTE) cells (homozygous for ΔF508-CFTR), and S9 cells (IB3-1 cells corrected with adenoassociated virus-CFTR) were maintained in LHC-8 medium (BIO-SOURCE) containing 100 units/ml penicillin, 100 μg/ml streptomycin, 0.25 μg/ml amphotericin B, and 10% fetal bovine serum (all from Invitrogen). The cells were plated on 6-well plates, transfected with 4 μg of each ΔF508/wt-CFTR-GFP plasmid DNA, and cotransfected with the VCP shRNA (ΔVCP), VCPQQ (deficient in AAA ATPase domains D1 and D2), gp78 small interfering RNA (Δgp78), or gp78ΔC (deficient in the VCP-binding domain) construct using Lipofectamine 2000 (Invitrogen) as recommended by the manufacturer. After 48 h of transfection, cells were rinsed three times and starved for 1 h in methionine- and cysteine-free Dulbecco's modified Eagle's medium. Cells were pulse-labeled with 250 μCi/ml [35S]methionine/cysteine (ICN Biomedical, Irvine, CA) for 30 min and then chased in Dulbecco's modified Eagle's medium containing 10 mm methionine and 4 mm cysteine for the indicated times. Fluorescence Microscopy—After 48 h of transfection, cells were washed three times with Hanks' balanced salt solution containing calcium and magnesium (Invitrogen) and loaded with 1 μm ER-Tracker™ Blue-White DPX dye (Invitrogen). Plates were incubated at 37 °C and 5% CO2 for 2 h and examined under a Zeiss Axiovert 135-N fluorescence microscope. A Quantix 1401 charge-coupled device camera and IPLab software Version 3.5 with appropriate filter settings for GFP (fluorescein isothiocyanate) or ER-Tracker Blue (4′,6-diamidino-2-phenylindole) were used to capture the images. Immunoprecipitation and Immunoblotting—Cells were lysed directly on plates using M-PER protein lysis buffer (Pierce) containing protease inhibitor mixture (Roche Applied Science) after three washes with ice-cold phosphate-buffered saline. CF bronchial brushings were transferred to lysis buffer. For immunoprecipitation, total protein extracts (500 μg/ml for cell culture and 50 μg/ml for bronchial brushings) were incubated with 50 μlof protein A/G-agarose beads (Santa Cruz Biotechnology, Inc.) for 3 h at 4 °C. After preclearing, 5 μg of respective primary antibody or preimmune serum (negative control) was added to each tube. After 1 h, protein A/G-agarose beads (50 μl) were added to each tube, and tubes were incubated overnight at 4 °C. Beads were washed once with lysis buffer (20 mm Tris-HCl (pH 7.6), 150 mm NaCl, 0.5% Triton X-100, and 10 μm phenylmethylsulfonyl fluoride), followed with two washes with phosphate-buffered saline. The beads were suspended in Laemmli sample buffer (30 μl) containing β-mercaptoethanol, vortexed for 1 min, resolved by 4-10% SDS-PAGE, and transferred to a 0.4-μm pore size nitrocellulose membrane. Proteins were detected using the respective primary antibodies. For pulse-chase experiments, CFTR immunoprecipitate was eluted with sample buffer and separated on a 4-8% SDS-polyacrylamide gel, dried for 2 h, and processed for autoradiography. IL8 Cytokine Enzyme-linked Immunosorbent Assay—IB3-1 cells were transfected with the ΔVCP, VCPQQ, Δgp78, or gp78ΔC construct and treated with 5 μm bortezomib or 5 mm 4-PBA. At 24 h post-transfection, the cells were induced with 1 ng/ml IL1β. After 48 h of transfection, supernatants were collected, and IL8 levels were measured by solid-phase enzyme amplified sensitivity immunoassay (BIOSOURCE) as specified by the manufacturer. Standards and high and low cytokine controls were included. The plates were read at 450 nm on a 96-well microplate reader (Molecular Devices Corp.) using SoftMax Pro software. The mean blank reading was subtracted from each sample and control reading. The amount of substrate turnover was determined calorimetrically by measuring the absorbance proportional to IL8 concentration. A standard curve was plotted, and an IL8 concentration in each sample was determined by interpolation from the standard curve. The data represent the means ± S.D. of three independent experiments. NoShift NFκB Binding Assay—IB3-1 cells transfected (24 h) with ΔVCP, ΔF508-CFTR, or ΔCHOP were treated with 5 μm bortezomib (6 h), 5 μm MLN-273 (6 h), or 5 mm 4-PBA (24 h). Cells were induced with IL1β (1 ng/ml) for 12 h. After 24 h of transfection, nuclear extracts (11Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9160) Google Scholar) were collected using a NucBuster protein extraction kit (Novagen, San Diego, CA), and the shift in bound NFκB was measured using a NoShift NFκB binding assay kit (Novagen) as specified by the manufacturer. The signal from nuclear extracts was compared with the negative control (minus the extract). The specificity of protein binding was established using NFκB-specific and mutant competitors. The plates were read at 450 nm on a 96-well microplate reader using SoftMax Pro software. The absorbance readings were used to determine the levels of bound NFκB. The data represent the means ± S.D. of three independent experiments. N-(Ethoxycarbonylmethyl)-6-methoxyquinolinium Bromide (MQAE) Assay—CFTR-mediated chloride transport activity in IB3-1 cells transfected with the ΔVCP, VCPQQ, Δgp78, or gp78ΔC construct and treated with bortezomib (1, 5, or 10 μm) was assayed using the halide-sensitive dye MQAE. Fluorescence of MQAE is quenched by halides. Cells were grown on glass coverslips in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. Cells were loaded with the dye by hypotonic shock at 37 °C for 40 min in Opti-MEM/water (1:1) containing 10 mm MQAE, washed, and then mounted in a perfusion chamber for fluorescence measurements. Fluorescence was measured using a Zeiss inverted microscope coupled to a charge-coupled device camera. Excitation and emission wavelengths were 350 and 460 nm, respectively. The stage and objective lenses were maintained at 37 °C. The medium was kept flowing through the perfusion chamber at 1 ml/min using a peristaltic pump. Both 10 μm forskolin and 10 μm genistein were used to induce Cl- transport in IB3-1 cells. CFTR was inhibited with either 5 μm CFTR inhibitor-172 (12) or myristoylated protein kinase A inhibitor 14-22 amide (calbiochem) to reduce cAMP-mediated phosphorylation. Chloride efflux was calculated using Equations 1, 2, 3. F0/FCl=1+[Cl−]i·KSV(Eq. 1) F0=F20·(1+0.02·KSV(Eq. 2) dCl/dt=F0/(KSV·(FCl)2)·dFCl/dt(Eq. 3) Statistical Analysis—All data are represented as the means ± S.D. of three experiments. One-way analysis of variance with Dunnett's planned comparison was run for each sample versus the control. A p value <0.05 was considered to have statistical significance. p97/VCP Participates in ERAD of ΔF508-CFTR—To test the hypothesis that VCP is involved in ΔF508-CFTR degradation, we first estimated VCP protein levels in freshly isolated bronchial epithelial cells from ΔF508 CF and non-CF subjects. As expected, VCP levels were up-regulated in all ΔF508 CF subjects compared with non-CF controls (Fig. 1A). Moreover, the difference between CF and non-CF bronchial expression was striking. We next hypothesized that transient knock-down of either VCP or gp78 would rescue ΔF508-CFTR from ERAD in CF bronchial epithelial cells. To reduce the expression of these proteins, we constructed short hairpin/small interfering RNA. The efficiency of VCP shRNA (ΔVCP)-mediated inhibition of VCP protein levels in IB3-1 cells (ΔF508/W1282X CF bronchial epithelial line) (13Zeitlin P.L. Lu L. Rhim J. Cutting G. Stetten G. Kieffer K.A. Craig R. Guggino W.B. Am. J. Respir. Cell Mol. Biol. 1991; 4: 313-319Crossref PubMed Scopus (273) Google Scholar) was evaluated by immunoblotting of whole cell lysates (Fig. 1B, upper panel). To localize ΔF508-CFTR signal, the IB3-1 cells were transfected with ΔF508-CFTR-GFP and cotransfected with ΔVCP or a plasmid control. Inhibition of VCP was associated with accumulation of ΔF508-CFTR-GFP in the ER compared with the control (Fig. 1B, lower panels). Accumulation of ΔF508-CFTR in the ER was confirmed by co-localization of the GFP signal with the signal from ER-Tracker Blue-White DPX. Furthermore, spreading of the GFP signal beyond the ER tracker dye compartment suggested that ΔF508-CFTR-GFP escaped from the ER in ΔVCP IB3-1 cells (Fig. 1C). p97/VCP Inhibition Rescues ΔF508-CFTR from ERAD—In IB3-1 cells, the ER-retained ΔF508-CFTR protein is core-glycosylated (160-kDa immature B form), whereas growth at 26 °C allows the ΔF508-CFTR protein to transit the biosynthetic pathway and to acquire complex glycosylation (180-kDa mature C form) (5Denning G.M. Anderson M.P. Amara J.F. Marshall J. Smith A.E. Welsh M.J. Nature. 1992; 358: 761-764Crossref PubMed Scopus (1061) Google Scholar). Moreover, the ΔF508-CFTR band C form has a faster turnover rate from the plasma membrane (14Sharma M. Benharouga M. Hu W. Lukacs G.L. J. Biol. Chem. 2001; 276: 8942-8950Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar). To assess the effects of ΔVCP on the stability of ΔF508-CFTR bands B and C, IB3-1 cells were first transiently transfected with ΔF508-CFTR-GFP for 48 h and then metabolically labeled with [35S]methionine. ΔF508-CFTR was immunoprecipitated with anti-CFTR antibody 169 (15Crawford I. Maloney P.C. Zeitlin P.L. Guggino W.B. Hyde S.C. Turley H. Gatter K.C. Harris A. Higgins C.F. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9262-9266Crossref PubMed Scopus (393) Google Scholar) after the indicated chase time (Fig. 2A, Control). Cotransfection with ΔVCP (Fig. 2A) resulted in stabilization of both B and C forms. By comparison, cotransfection with gp78 small interfering RNA (Δgp78) produced only a transient rescue of the mature C form with a peak at 1 h (Fig. 2A), suggesting that VCP (not gp78) is central to extraction of CFTR from the ER for ERAD. S9 cells (IB3-1 cells corrected with wt-CFTR) were similarly transfected with additional wt-CFTR and ΔVCP. We observed an efficient maturation and stability of band B to band C (Fig. 2B), confirming that wt-CFTR and ΔF508-CFTR are extracted and degraded through the same VCP-mediated pathway.FIGURE 2p97/VCP is involved in ERAD of CFTR, and inhibition of VCP or proteasome degradation by bortezomib/PS-341 can rescue CFTR. IB3-1 cells were transfected with ΔF508-CFTR for 48 h, metabolically labeled for 30 min with Tran35S-label, and chased for the indicated time periods. ΔF508-CFTR was immunoprecipitated using rabbit anti-CFTR polyclonal antibody 169. A, IB3-1 cells were transfected with ΔF508-CFTR and cotransfected with ΔVCP or Δgp78 for 48 h. VCP/gp78 inhibition resulted in accumulation of ΔF508-CFTR (B form) and partial rescue of the mature C form. B, S9 cells were transfected with wt-CFTR for 48 h or treated with 10 μm PS-341 for 6 h at 42 h post-transfection. Transfected cells were metabolically labeled for 30 min with Tran35S-label and chased for the indicated time periods. wt-CFTR was immunoprecipitated using rabbit anti-CFTR polyclonal antibody 169. VCP inhibition rescued wt-CFTR, whereas proteasome modulation by PS-341 stabilized the wt-CFTR mature C form. Data are the means ± S.D. of three experiments. C, CFTE cells were transfected with ΔF508-CFTR. At 42 h post-transfection, cells were treated with 0 or 10 μm PS-341 for 6 h. Proteasome modulation by PS-341 rescued the ΔF508-CFTR mature C form by 2 h. D, IB3-1 cells were transfected with pCIneo, pSM2, pcDNA3, gp78ΔC, ΔHsp70, ΔVCP, Δgp78, or VCPQQ for 48 h or treated with 10 μm PS-341 for 6 h. Both VCP inhibition and proteasome modulation by PS-341 partially rescued ΔF508-CFTR. Data are the means ± S.D. of three experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We considered the proteasomal compartment as a potential therapeutic target for CF not only to test the role of VCP in proteasome-mediated degradation of CFTR, but also because both VCP and proteasome inhibitors are known to stabilize IκB, the inhibitor of the NFκB-mediated inflammatory response (16Dai R.M. Chen E. Longo D.L. Gorbea C.M. Li C.C. J. Biol. Chem. 1998; 273: 3562-3573Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar, 17Hideshima T. Chauhan D. Richardson P. Mitsiades C. Mitsiades N. Hayashi T. Munshi N. Dang L. Castro A. Palombella V. Adams J. Anderson K.C. J. Biol. Chem. 2002; 277: 16639-16647Abstract Full Text Full Text PDF PubMed Scopus (853) Google Scholar). We used bortezomib (6-h treatment) at 10 μm, which leads to partial inhibition of protease activity in IB3-1 cells. Phase microscopic examination revealed no difference in morphology of treated and untreated monolayers (data not shown). To study the effect of bortezomib on another epithelial cell type homozygous for ΔF508-CFTR, we transfected CFTE cells (homozygous for ΔF508-CFTR) (18Kunzelmann K. Schwiebert E.M. Zeitlin P.L. Kuo W.L. Stanton B.A. Gruenert D.C. Am. J. Respir. Cell Mol. Biol. 1993; 8: 522-529Crossref PubMed Scopus (108) Google Scholar) with ΔF508-CFTR-GFP. After 42 h of transfection, cells were induced with bortezomib (10 μm) for 6 h. We observed a significant increase in the accumulation and stabilization of the B form with 10 μm bortezomib compared with the untreated control (Fig. 2C). S9 cells transfected with wt-CFTR and exposed to bortezomib similarly produced substantial amounts of mature band C (Fig. 2B). To study the effect of inhibiting components of ubiquitination and proteasome degradation on ERAD, we first compared the relative basal levels of the immature B and mature C forms of ΔF508-CFTR in IB3-1 cells by metabolic labeling (t = 2 h) (Fig. 2D, lane 1). We observed no changes in the levels of the B and C forms of ΔF508-CFTR upon transfecting IB3-1 cells with empty vectors (pCIneo/pcDNA3/pSM2) compared with the control (lanes 2-4). In contrast, both VCP and gp78 inhibition resulted in accumulation of the B form compared with the control, whereas the C form showed a more significant increase with VCP inhibition compared with a minimal increase with gp78 inhibition (lanes 7 and 8). Because VCP physically interacts with gp78 (8Zhong X. Shen Y. Ballar P. Apostolou A. Agami R. Fang S. J. Biol. Chem. 2004; 279: 45676-45684Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar), it is expected that the gp78-VCP interaction may represent one way of coupling ubiquitination with retrotranslocation and degradation of ΔF508-CFTR. To evaluate the effect of this interaction on ERAD of ΔF508-CFTR, we used a gp78ΔC construct deficient in the VCP-binding domain; no change in the levels of the B and C forms of ΔF508-CFTR compared with the control was observed (lane 5), suggesting that this gp78-VCP interaction is required for ERAD of ΔF508-CFTR. Moreover, the VCPQQ construct (deficient in AAA ATPase domains D1 and D2) partially rescued the B and C forms of ΔF508-CFTR (lane 9), indicating that two AAA ATPase domain are involved in ERAD of ΔF508-CFTR. The level of the C form was lower after transfection with the VCPQQ construct compared with complete VCP gene inhibition (ΔVCP) probably due to residual VCP AAA ATPase domain activity. Interference with Hsp70 expression (lane 6) did not rescue CFTR, which we expected because it is the increase in Hsp70 expression that promotes maturation of band B to C (19Choo-Kang L.R. Zeitlin P.L. Am. J. Physiol. 2001; 281: L58-L68Crossref PubMed Google Scholar). The inhibition of proteasome-mediated degradation by bortezomib partially rescued ΔF508-CFTR from ERAD (lane 10). To investigate the effects of bortezomib on components of ERAD, IB3-1 cells were treated with bortezomib for 6 h and then immunoblotted for ERAD components. Induction of Hsp70 and inhibition of VCP were observed with no change in gp78 and Hsp40 (Fig. 3A). p97/VCP Interacts with the CFTR Immunocomplex—To confirm that both ΔF508-CFTR and wt-CFTR are VCP substrates, we immunoprecipitated CFTR from IB3-1 and S9 total protein extracts (500 μg/ml) using rabbit anti-CFTR polyclonal antibody 169 (15Crawford I. Maloney P.C. Zeitlin P.L. Guggino W.B. Hyde S.C. Turley H. Gatter K.C. Harris A. Higgins C.F. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9262-9266Crossref PubMed Scopus (393) Google Scholar). VCP was co-immunoprecipitated with both ΔF508-CFTR and wt-CFTR (Fig. 3B, upper panel), indicating VCP to be the integral component of ERAD of CFTR. It is possible that VCP interacts with residual ΔF508-CFTR in the S9 cell line. Anti-VCP antibody was used as a positive control, and preimmune serum was used as a negative control for immunoprecipitation from IB3-1 cells. We also observed that VCP was co-immunoprecipitated with Hsp40 probably as part of the ΔF508-CFTR immunocomplex from IB3-1 cells (Fig. 3C). To understand the mechanism of VCP-mediated ERAD of CFTR, we analyzed the interaction of VCP with other molecular chaperones known to be associated with ΔF508-CFTR or wt-CFTR degradation machinery. We immunoprecipitated CFTR, Hsp40, Hsp90, Hsc70, Hsp70, CHIP, and VCP from IB3-1 and S9 total protein extracts (500 μg/ml) to evaluate relative VCP levels from each IB3-1 and S9 immunoprecipitate. We found that VCP was independently co-immunoprecipitated with ΔF508-CFTR, Hsp40, Hsp90, Hsc70, Hsp70, and CHIP from IB3-1 cells (Fig. 4A). Relatively higher amounts of VCP were pulled down with anti-Hsp40 and anti-Hsc70 antisera compared with other proteins, suggesting a stronger interaction or higher stoichiometry. VCP was pulled down together with Hsp90 and Hsp70 immunocomplexes from IB3-1 cells, but not from S9 cells (Fig. 4A). Moreover, VCP had a higher stoichiometry for these molecular chaperones in the presence of ΔF508-CFTR (IB3-1 cells) compared with wt-CFTR (S9 cells). Freshly isolated bronchial epithelial cells brushed from CF patients homozygous for ΔF508-CFTR were examined by immunoprecipitation of individual components of ERAD and immunoblotting for VCP or Hsc70 (Fig. 4B). Again, VCP and Hsc70 were prominent with anti-Hsp40 antibody. VCP Inhibition and Bortezomib Treatment Induce Chloride Efflux—To confirm that ΔF508-CFTR rescue from ERAD leads to functional cell-surface chloride channels, we me