Abstract

BC15-31 is a DNA aptamer that targets heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), which plays a crucial role in the process of pre-RNA maturation and is also essential for the rapid proliferation of tumor cells. In this research, we modified BC15-31 with a phosphorothioate (PS) backbone, LNA, and 2-O-MOE to enhance its stability and target affinity. In addition, a neutral cytidinyl lipid (DNCA) and a cationic lipid (CLD) were mixed to encapsulate modified aptamers with the aim of improving their cell permeability with low toxicity. Under the DNCA/CLD package, aptamers are mainly distributed in the nucleus. A modified sequence WW-24 showed an excellent selective anti-melanoma (A375 cells, ∼25 nM, 80%) activity, targeted to both hnRNP A1 and hnRNP A2/B1 found by the BLI experiment, and induced more early and late apoptosis in vitro, which also showed stronger antitumor effect and longer accumulation time in vivo. These results provide a new strategy for further clinical applications.

Highlights

  • Aptamers, which Szostak and Ellington first reported in 1990, are single-stranded oligonucleotides or peptides

  • The only aptamer-based drug approved by the FDA occurred in 2004, which was for the treatment of neovascular age-related macular degeneration (AMD)

  • BC15 (74 nt) is a DNA aptamer that was found by tissue slide-based SELEX, which has a high affinity to hnRNP A1 and A2/B1 (Li et al, 2009), showing better antiproliferation activity in the HepG2 cell line (Ku et al, 2015)

Read more

Summary

INTRODUCTION

Aptamers, which Szostak and Ellington first reported in 1990, are single-stranded oligonucleotides or peptides. BC15 (74 nt) is a DNA aptamer that was found by tissue slide-based SELEX, which has a high affinity to hnRNP A1 and A2/B1 (Li et al, 2009), showing better antiproliferation activity in the HepG2 cell line (Ku et al, 2015). With the mixture of DNCA and CLD as a carrier, a modified aptamer WW24 (25 nM) showed higher target affinity and serum stability, which entered the nucleus, exerting a selective anti-melanoma activity, which could target hnRNP A1 and A2/B1. It showed better antitumor effect and longer accumulation time in vivo

MATERIALS AND METHODS
17 BC15-31 TGTGGCGAGGTAGGTGGGGTGTGTGTGTATC
RESULTS
DISCUSSION
ETHICS STATEMENT
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call