Abstract
The pepper weevil, Anthonomus eugenii Cano (Coleoptera: Curculionidae), is the main insect pest of peppers (Capsicum spp.) throughout the southern U.S. and a potential target for novel control methods that may require gene expression analyses. Careful selection of adequate reference genes to normalize RT-qPCR data is an important prerequisite for gene expression studies since the expression stability of reference genes can be affected by the experimental conditions leading to biased or erroneous results. The lack of studies on validation of reference genes for RT-qPCR analysis in A. eugenii limits the investigation of gene expression, therefore it is needed a systematic selection of suitable reference genes for data normalization. In the present study, three programs (BestKeeper, geNorm and NormFinder) were used to analyze the expression stability of candidate reference genes (β-ACT, ArgK, EF1-α, GAPDH, RPL12, RPS23, α-TUB, 18S and 28S) in A. eugenii under different experimental conditions. Our results revealed that the most stably expressed reference genes in A. eugenii varied according to the experimental condition evaluated: developmental stages (EF1-α, 18S and RPL12), sex (RPS23 and RPL12), low temperature (GAPDH and α-TUB), high temperature (α-TUB and RPS23), all temperatures (α-TUB and GAPDH), starvation (RPL12 and α-TUB), and dsRNA exposure (α-TUB and RPL12). Our study provides for the first time valuable information on appropriate reference genes that can be used in the analysis of gene expression by RT-qPCR in biological experiments involving A. eugenii.
Highlights
Reverse-transcription quantitative PCR (RT-qPCR) is widely used in gene expression studies due to its simplicity, reproducibility, high sensitivity, accuracy and cost-effectiveness[1,2]
Molecular studies provide important information about the genetic mechanisms underlying a variety of biological events and metabolic pathways, but only a few studies at the molecular level have been performed on A. eugenii
Differences in the stability of potential reference genes were evaluated in order to select appropriate normalization factors for gene expression analysis in A. eugenii
Summary
Reverse-transcription quantitative PCR (RT-qPCR) is widely used in gene expression studies due to its simplicity, reproducibility, high sensitivity, accuracy and cost-effectiveness[1,2]. RT-qPCR is considered a highly accurate technique, several experimental factors can lead to results that are not reliable measurements of gene expression. These factors include purity and integrity of RNA, quantity of starting RNA and cDNA, reverse transcription and PCR efficiency, and pipetting errors[3]. The selection of suitable reference genes according to the specific experimental conditions is essential to ensure accurate results. A. eugenii larvae feed preferentially inside floral buds and immature fruits, while. CTCGAAGCTCTCCTTCAACG adults feed on buds, flowers, fruits, and even young leaves. Premature abscission of the fruits as a result of larval and adult feeding leads to losses in the production of marketable fruits which is the main damage caused by this insect[16]
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
