Abstract
Atypical parkinsonian disorders (APDs) comprise a group of neurodegenerative diseases with heterogeneous clinical and pathological features. Most APDs are sporadic, but rare familial forms have also been reported. Epidemiological and post-mortem studies associated APDs with oxidative stress and cellular protein aggregates. Identifying molecular mechanisms that translate stress into toxic protein aggregation and neurodegeneration in APDs is an active area of research. Recently, ribonucleic acid (RNA) stress granule (SG) pathways were discussed to be pathogenically relevant in several neurodegenerative disorders including APDs. Using whole genome sequencing, mRNA expression analysis, transfection assays and cell imaging, we investigated the genetic and molecular basis of a familial neurodegenerative atypical parkinsonian disorder. We investigated a family with six living members in two generations exhibiting clinical symptoms consistent with atypical parkinsonism. Two affected family members suffered from parkinsonism that was associated with ataxia. Magnetic resonance imaging (MRI) of these patients showed brainstem and cerebellar atrophy. Whole genome sequencing identified a heterozygous stop-gain variant (c.C811T; p.R271X) in the Poly(A) binding protein, cytoplasmic 4-like (PABPC4L) gene, which co-segregated with the disease in the family. In situ hybridization showed that the murine pabpc4l is expressed in several brain regions and in particular in the cerebellum and brainstem. To determine the functional impact of the stop-gain variant in the PABPC4L gene, we investigated the subcellular localization of PABPC4L in heterologous cells. Wild-type PABPC4L protein localized predominantly to the cell nucleus, in contrast to the truncated protein encoded by the stop-gain variant p.R271X, which was found homogeneously throughout the cell. Interestingly, the wild-type, but not the truncated protein localized to RasGAP SH3 domain Binding Protein (G3BP)-labeled cytoplasmic granules in response to oxidative stress induction. This suggests that the PABPC4L variant alters intracellular distribution and possibly the stress granule associated function of the protein, which may underlie APD in this family. In conclusion, we present genetic and molecular evidence supporting the role of a stop-gain PABPC4L variant in a rare familial APD. Our data shows that the variant results in cellular mislocalization and inability of the protein to associate with stress granules.
Highlights
Atypical parkinsonian disorders (APDs) comprise a group of neurodegenerative diseases with heterogeneous clinical and pathological features
We investigated the genetic basis of a familial APD segregating as autosomal dominant condition and found a rare stop-gain variant in the stress granule associated protein PABPC4L as an underlying cause
During the two years, he developed Parkinson-like symptoms comprising rigidity and bradykinesia as well as progression of his ataxia and downbeat nystagmus
Summary
The genomic regions harboring prioritized variants were amplified using predesigned commercially obtained M13-tailed primer pairs [Primer ID (Gene_ID) Hs00253986_CE (PABPC4L), Hs00278134_CE (ZNF292), Hs00278167_CE (C6orf163), Thermo Fischer Scientific Inc.]. Bi-directional Sanger sequencing was performed with M13 forward (TGTAAAACGACGGCCAGT) and reverse (CAGGAAACAGCTATGACC) primers (StarSEQ GmBH, Mainz, Germany). PABPC4L cDNA clone carrying the c.C811T variant encoding p.R271X was generated using Phusion Site-Directed Mutagenesis Kit (Thermo Fischer Scientific Inc.) and mutagenic primer AGAAAGTCGAGTGACAGGCTGAG (variant position is underlined) according to manufacturer’s instructions. Flag-tagged PABPC4L constructs was generated with PCR using forward primer containing the FLAG tag encoding sequence GACTACAAAGACGATGACGACAAG containing HindIII site. Cell cultures were tested for mycoplasma contamination prior to experiments using PCR Mycoplasma Test Kit I/C (PK-CA91-1024, PromoCell GmbH, Germany). Cells were imaged for mCherry (expressed as a fusion protein with wild-type or PABPC4L:p.R271X variant) and DAPI fluorescence. P-values of less than 0.05 were considered statistically significant
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.