Abstract
Protein S-thiolation is a post-translational thiol-modification that controls redox-sensing transcription factors and protects active site cysteine residues against irreversible oxidation. In Bacillus subtilis the MarR-type repressor OhrR was shown to sense organic hydroperoxides via formation of mixed disulfides with the redox buffer bacillithiol (Cys-GlcN-Malate, BSH), termed as S-bacillithiolation. Here we have studied changes in the transcriptome and redox proteome caused by the strong oxidant hypochloric acid in B. subtilis. The expression profile of NaOCl stress is indicative of disulfide stress as shown by the induction of the thiol- and oxidative stress-specific Spx, CtsR, and PerR regulons. Thiol redox proteomics identified only few cytoplasmic proteins with reversible thiol-oxidations in response to NaOCl stress that include GapA and MetE. Shotgun-liquid chromatography-tandem MS analyses revealed that GapA, Spx, and PerR are oxidized to intramolecular disulfides by NaOCl stress. Furthermore, we identified six S-bacillithiolated proteins in NaOCl-treated cells, including the OhrR repressor, two methionine synthases MetE and YxjG, the inorganic pyrophosphatase PpaC, the 3-D-phosphoglycerate dehydrogenase SerA, and the putative bacilliredoxin YphP. S-bacillithiolation of the OhrR repressor leads to up-regulation of the OhrA peroxiredoxin that confers together with BSH specific protection against NaOCl. S-bacillithiolation of MetE, YxjG, PpaC and SerA causes hypochlorite-induced methionine starvation as supported by the induction of the S-box regulon. The mechanism of S-glutathionylation of MetE has been described in Escherichia coli also leading to enzyme inactivation and methionine auxotrophy. In summary, our studies discover an important role of the bacillithiol redox buffer in protection against hypochloric acid by S-bacillithiolation of the redox-sensing regulator OhrR and of four enzymes of the methionine biosynthesis pathway.
Highlights
From the ‡Institute for Microbiology and §Interfaculty Institute for Genetics and Functional Genomics, Ernst-Moritz-Arndt-University of Greifswald, D-17487 Greifswald, Germany
Exposure of cells to 50 M NaOCl stress caused a lag in growth for 60 min and growth was resumed with a similar growth rate as the untreated control (Fig. 1)
The redox proteome in response to NaOCl has been recently studied in E. coli using the OxICAT approach and several redox-sensitive proteins could be identified that are sensitive to NaOCl-directed reversible oxidation [28, 29]
Summary
Bacterial Strains and Growth Conditions—The bacterial strains used were B. subtilis wild-type strains 168 (trpC2), JH642 (trpC2 attSP), and CU1065 (trpC2 pheA1) and mutant strains ⌬spx (trpC2,spx::neor) [32], ⌬ohrR (trpC2,ohrR::cmr), ⌬ohrA (trpC2, ohrA::cmr), ⌬sigB (trpC2,sigB::cmr), ⌬perR (trpC2,perR::cmr) [33], HB9121 (CU1065 trpC2,ohrR::kmr ohrR-FLAG (Spcr) ohrA-cat lacZ (Neor) [19], HB2048 (CU1065 SPc2⌬2::Tn917::(ohrA-catlacZ)ohrR::kan,thrC::pXTohrRC15S) [34], HB11002 (CU1065 trpC2, bshA::mlsr), and HB11053 (CU1065 trpC2, bshB1:: spcr bshB2::cmr) [35]. LTQ-Orbitrap Velos Mass Spectrometry and Identification of Posttranslational Thiol-modifications—B. subtilis wild-type and ⌬bshA mutant cells were harvested before (control conditions) and 15 min after exposure to 50 M NaOCl stress. Transcriptome Analysis—For microarray analysis, B. subtilis wildtype cells were grown in minimal medium to OD500 of 0.4 and harvested before and 10 min after exposure to 50 M NaOCl. Total RNA was isolated by the acid phenol method as described [42]. Northern Blot Experiments—Northern blot analyses were performed as described [49] using RNA isolated from B. subtilis wild-type cells before (control) and 10 min after treatment with 50 M NaOCl, 1 mM diamide and 100 M CHP, respectively. Hybridizations specific for ohrA, nfrA, cysK, katA, ohrA, azoR1, catE, and yitJ were performed with the digoxigenin-labeled RNA probes synthesized in vitro using T7 RNA polymerase from T7 promoter containing internal PCR products of the respective genes using the primer sets described previously [23, 25, 35] and the primer pairs yitJ-for, 5Ј CCGAACAGCAGTCTTCCTTC 3Ј and yitJ-T7-rev, 5Ј CTAATACGACTCACTATAGGGAGACCGTTTTACCGCTTTATCCA 3Ј for yitJ
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
