Abstract
The MPH1 (mutator pHenotype 1) gene of Saccharomyces cerevisiae was identified on the basis of elevated spontaneous mutation rates of haploid cells deleted for this gene. Further studies showed that MPH1 functions to channel DNA lesions into an error-free DNA repair pathway. The Mph1 protein contains the seven conserved motifs of the superfamily 2 (SF2) family of nucleic acid unwinding enzymes. Genetic analyses have found epistasis of the mph1 deletion with mutations in the RAD52 gene group that mediates homologous recombination and DNA repair by homologous recombination. To begin dissecting the biochemical functions of the MPH1-encoded product, we have expressed it in yeast cells and purified it to near homogeneity. We show that Mph1 has a robust ATPase function that requires single-stranded DNA for activation. Consistent with its homology to members of the SF2 helicase family, we find a DNA helicase activity in Mph1. We present data to demonstrate that the Mph1 DNA helicase activity is fueled by ATP hydrolysis and has a 3' to 5' polarity with respect to the DNA strand on which this protein translocates. The DNA helicase activity of Mph1 is enhanced by the heterotrimeric single-stranded DNA binding protein replication protein A. These results, thus, establish Mph1 as an ATP-dependent DNA helicase, and the availability of purified Mph1 should facilitate efforts at deciphering the role of this protein in homologous recombination and mutation avoidance.
Highlights
DNA helicases are involved in essentially all the metabolic pathways that entail melting of the DNA double helix, such as DNA replication, homologous recombination (HR),1 and DNA repair reactions [1, 2]
Certain DNA helicase enzymes, e.g. those that belong to the RecQ helicase family, are specific for DNA structures that arise during homologous recombination and when replication forks stall [1, 2]
The DNA damage sensitivity and mutator phenotype of the mph1⌬ mutant are epistatic to mutations in genes that belong to the RAD52 epistasis group required for HR, the homology-directed repair of damaged DNA, and the restart of stalled DNA replication forks
Summary
GATAAAACTC GAGTTTTATCGCTTCCATGACGCAGAAG CAGAAAATCGAAATCATCTTCGGTTAAATC tid recombination events are compromised. Taken together, the available genetic data are consistent with the premise that Mph protein functions to channel DNA lesions or DNA intermediates that are associated with damaged replication forks into HR or that it is involved in the resolution of such DNA intermediates by HR. As part of our overall effort at delineating the mechanism of HR pathways, we would like to define the biochemical properties of the Mph protein and its interactions with proteins of the RAD52 epistasis group. Toward this goal, we have overexpressed Mph in yeast, devised a procedure for its purification to near homogeneity, and carried out initial biochemical characterization of the purified protein to show that it has ssDNAdependent ATPase and DNA helicase activities. The availability of purified Mph and the demonstration of its catalytic activities should facilitate future efforts aimed at deciphering the role of this factor and its orthologues in homologous recombination and mutation avoidance
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
