Year-end Sale % OFF 
Abstract
Cellular functions of the REV1 gene have been conserved in evolution and appear important for maintaining genetic integrity through translesion DNA synthesis. This study documents a novel biochemical activity of human REV1 protein, due to higher affinity for single-stranded DNA (ssDNA) than the primer terminus. Preferential binding to long ssDNA regions of the template strand means that REV1 is targeted specifically to the included primer termini, a property not shared by other DNA polymerases, including human DNA polymerases alpha, beta, and eta. Furthermore, a mutant REV1 lacking N- and C-terminal domains, but catalytically active, lost this function, indicating that control is not due to the catalytic core. The novel activity of REV1 protein might imply a role for ssDNA in the regulation of translesion DNA synthesis.
Highlights
REV1 is a member of the Y family of DNA polymerases, which includes DNA polymerase2 IV and V in Escherichia coli, and DNA pol , , and in eukaryotes [14, 15]
High Affinity Binding of REV1 to single-stranded DNA (ssDNA)—During biochemical characterization of the dCMP transferase reactions of human REV1 protein, we found a synthetic oligonucleotide, H1, to be a strong inhibitor of the transferase activity of the REV1 (Fig. 1A)
We demonstrated that REV1 could not transfer dCMP to the 3Ј end of the d(C-T)30, 60-mer oligonucleotide, under those reaction conditions, indicating that the inhibition is not because of random priming reactions with the oligonucleotide
Summary
Oligonucleotides—The oligonucleotide sequences were as follows: H1, 5Ј-GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCCG-3Ј; H2, 5Ј-CGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTC-3Ј; H3, 5Ј-GACGTCATAGACGATTACATTGCTAGGACATGCTGTCTAGAGACTATCGC-3Ј; and H4, 5ЈGCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGTC-3Ј. The standard reaction mixture (25 l) contained 50 mM Tris-HCl buffer, pH 8.0, 2 mM MgCl2, 0.1 mg/ml BSA, 5 mM dithiothreitol, 0.1 mM dCTP, 100 nM primer-template, and 1 l of protein sample diluted with buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 10 mM -mercaptoethanol, 10% glycerol, 0.1 mg/ml BSA) as indicated. The reaction mixture (25 l) contained 50 mM Tris-HCl buffer, pH 8.0, 2 mM MgCl2, 0.1 mg/ml BSA, 5 mM dithiothreitol, 0.1 mM each of dGTP, dATP, dTTP, and [␣-32P]dCTP (GE Healthcare), 100 nM primer-template (P5786T), and 1 l of protein sample diluted with buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 10 mM -mercaptoethanol, 10% glycerol, 0.1 mg/ml BSA) as indicated. The gels were dried and autoradiographed at Ϫ80 °C
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
