Abstract
Tyrosine 343 in human sulfite oxidase (SO) is conserved in all SOs sequenced to date. Intramolecular electron transfer (IET) rates between reduced heme (Fe(II)) and oxidized molybdenum (Mo(VI)) in the recombinant wild-type and Y343F human SO were measured for the first time by flash photolysis. The IET rate in wild-type human SO at pH 7.4 is about 37% of that in chicken SO with a similar decrease in k(cat). Steady-state kinetic analysis of the Y343F mutant showed an increase in K(m)(sulfite) and a decrease in k(cat) resulting in a 23-fold attenuation in the specificity constant k(cat)/K(m)(sulfite) at the optimum pH value of 8.25. This indicates that Tyr-343 is involved in the binding of the substrate and catalysis within the molybdenum active site. Furthermore, the IET rate constant in the mutant at pH 6.0 is only about one-tenth that of the wild-type enzyme, suggesting that the OH group of Tyr-343 is vital for efficient IET in SO. The pH dependences of IET rate constants in the wild-type and mutant SO are consistent with the previously proposed coupled electron-proton transfer mechanism.
Highlights
In vertebrates the molybdenum cofactor-containing enzyme sulfite oxidase (SO,1 EC 1.8.3.1) catalyzes the oxidation of sulfite to sulfate with the reduction of two equivalents of ferricytochrome c (Equation 1) [1, 2], according to the following equation
The two-electron-reduced SO, which is in the MoIV/FeIII state, undergoes intramolecular electron transfer (IET) to generate the MoV/FeII state that can be detected by electron paramagnetic resonance (EPR) spectroscopy
We have previously shown that exogenous flavin radicals generated in situ with a laser pulse will rapidly reduce the heme center of SO by one electron (Fig. 2) and have used this unique technique to investigate IET between the molybdenum and iron centers as a function of pH values (10Ϫ12)
Summary
Site-directed Mutagenesis—The Y343F mutation was introduced into pTG918 [24] using the Transformer Site-directed Mutagenesis kit (Clontech) with the mutagenic primer Y343F (GGCGGGATTTCAAAGGCTTCTC). Fractions exhibiting an A414/A280 ratio of 0.96 or greater were pooled and used in the experiments described in this study. Laser Flash Photolysis—Laser flash photolysis experiments were performed anaerobically on 0.50-ml solutions containing ϳ90 M 5-deazariboflavin (dRF) and 0.5 mM freshly prepared semicarbazide as a sacrificial reductant. The laser apparatus and associated visible absorbance detection system have been extensively described [31] as has the basic photochemical process by which 5-deazariboflavin semiquinone (dRFH1⁄7) is generated by reaction between triplet state dRF and the sacrificial reductant and used to reduce redox-active proteins (32Ϫ34). Initial velocities were determined by following the reduction of a freshly prepared oxidized cytochrome c (type VI, Sigma) solution at 550 nm, using an extinction coefficient change of 19,630 MϪ1 cmϪ1 [35]. The total concentrations of the wild-type and Y343F human SO are 2.6 ϫ 10Ϫ10 M and 4.3 ϫ 10Ϫ10 Ϫ 1.1 ϫ 10Ϫ9 M, respectively
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
