RNA-seq reveals the circular RNA and miRNA expression profile of peripheral blood mononuclear cells in patients with rheumatoid arthritis.

Jianting Wen,Hui Jiang,Pingheng Zhang,Yue Sun,Lei Wan,Yan Long,Dan Huang,Yanqiu Sun,Ying Zhang,Bingxi Bao,Ling Xin,Jian Liu,Guanghan Sun

doi:10.1042/bsr20193160

Abstract

Objective: Circular RNAs (circRNAs) are a significant class of molecules involved in a wide range of diverse biological functions that are abnormally expressed in many types of diseases. The present study aimed to determine the circRNAs specifically expressed in peripheral blood mononuclear cells (PBMCs) from rheumatoid arthritis (RA) patients to identify their possible molecular mechanisms.Methods: To identify the circRNAs specifically expressed in RA, we started by sequencing the of PBMCs circRNA and microRNAs (miRNAs) from a RA group (n = 3) and a control group (n = 3). We constructed a network of differentially expressed circRNAs and miRNAs. Then, we selected differentially expressed circRNAs in PBMCs from 10 RA patients relative to 10 age- and sex-matched controls using real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR). Spearman’s correlation test was used to evaluate the correlation of circRNAs with biochemical measurements.Results: A total of 165 circRNAs and 63 miRNAs were differently expressed between RA patients and healthy people according to RNA-seq, including 109 circRNAs that were significantly up-regulated and 56 circRNAs that were down-regulated among the RA patients. RT-qPCR validation demonstrated that the expression levels of hsa_circ_0001200, hsa_circ_0001566, hsa_circ_0003972, and hsa_circ_0008360 were consistent with the results from the sequencing analysis. Then, we found that there were significant correlations between the circRNAs and disease severity.Conclusion: Generally, these results suggest that expression of hsa_circ_0001200, hsa_circ_0001566, hsa_circ_0003972, and hsa_circ_0008360 in PBMCs from RA patients may serve as potential biomarkers for the diagnosis of RA, and these circRNAs may influence the occurrence and development of RA.

Highlights

Rheumatoid arthritis (RA) is a chronic disease characterized by autoimmunity and systemic inflammation [1]
Great efforts have been made to explore the molecular mechanisms of RA [13,14]; the majority of previous studies have concentrated on protein-coding genes
Several recent studies have shown that hsa circ 0044235, hsa circ RNA 104871 and hsa circ RNA 003524 in peripheral blood mononuclear cell (PBMC) participate in the pathogenesis of RA and can be used as potential biomarkers of RA by microarray analysis [21,22]

Summary

Objective

Circular RNAs (circRNAs) are a significant class of molecules involved in a wide range of diverse biological functions that are abnormally expressed in many types of diseases. Methods: To identify the circRNAs expressed in RA, we started by sequencing the of PBMCs circRNA and microRNAs (miRNAs) from a RA group (n = 3) and a control group (n = 3). We constructed a network of differentially expressed circRNAs and miRNAs. we selected differentially expressed circRNAs in PBMCs from 10 RA patients relative to 10 age- and sex-matched controls using real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR). RT-qPCR validation demonstrated that the expression levels of hsa circ 0001200, hsa circ 0001566, hsa circ 0003972, and hsa circ 0008360 were consistent with the results from the sequencing analysis. Conclusion: Generally, these results suggest that expression of hsa circ 0001200, hsa circ 0001566, hsa circ 0003972, and hsa circ 0008360 in PBMCs from RA patients may serve as potential biomarkers for the diagnosis of RA, and these circRNAs may influence the occurrence and development of RA. Accepted Manuscript online: 19 March 2020 Version of Record published: 03 April 2020

Introduction

Materials and methods

F: GGAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATGG F: CGGACAGGAGTGAGGAGAAG R

Findings

Discussion