Abstract

A highly purified nucleolar associated endoribonuclease was tested for possible involvement in the processing of precursor ribosomal RNA at a primary cleavage site approximately 650 nucleotides downstream from the transcription initiation site. Preribosomal RNA sequences containing the +650 region were synthesized in vitro and subsequently digested over a range of concentrations of the nucleolar endoribonuclease. Cleavages generated by the nucleolar endoribonuclease were localized both by S1 nuclease protection analysis and primer extension analysis. A more precise determination of the specificity of cleavage was achieved by chemical cleavage DNA sequence analysis. These data demonstrated that the purified nucleolar endoribonuclease specifically cleaved the precursor ribosomal RNA transcript at the +650 site. Additional enzyme-dependent cleavages were observed upstream to the +650 site in a region which is rapidly degraded following processing at the +650 site in vivo. No major cleavages were observed for a distance of approximately 250 nucleotides downstream from the +650 site in a conserved region of sequence previously shown to be important in specifying processing at the +650 site. As a control, pancreatic ribonuclease, a single strand-specific endoribonuclease, was shown not to produce similar cleavages in the +650 region, indicating that cleavage by the nucleolar RNase was not simply due to accessibility of the RNA at the +650 site. Taken together, these results suggest that the nucleolar endoribonuclease may be necessary and sufficient to catalyze one of the initial endonucleolytic cleavages in preribosomal RNA processing.

Highlights

  • From the Department of Biochemistryand Mofecular Siobgy, Uniuersity of South Florida College of Medicine, Tampa, Florida 33612

  • A highly purified nucleolar associated endoribonu- processing events which release the 5’ and 3‘ termini of the clease was tested for possible involvement tihne proc- mature 18,5.8, and 28 S rRNA species (Bachellerie et al, essing of precursor ribosomal RNA at a primary cleav- 1983; Bowman et al, 1981; Dudov et al, 1978; Hadjiolova et age site approximately 650 nucleotides downstream al., 1984a; Hadjiolova et al, 1984b; Kominami et al, 1978)

  • One early cleavage event representing the latter case takes place in a region approxiachieved by chemical cleavaDgNe A sequence analysis. mately 650 nucleotides downstream of the transcription iniThese data demonstrated that the purified nucleolar tiation site (Craig et al, 1987; Kass et al, 1987; Miller and endoribonuclease cleaved the precurrsio-r Sollner-Webb, 1981)

Read more

Summary

Ribosomal RNA Processing

LIMITED CLEAVAGES OF MOUSE PRERIBOSOMAL RNA BY A NUCLEOLAR ENDORIBONUCLEASE INCLUDE THE EARLY+650 PROCESSING SITE*. Mately 650 nucleotides downstream of the transcription iniThese data demonstrated that the purified nucleolar tiation site (Craig et al, 1987; Kass et al, 1987; Miller and endoribonuclease cleaved the precurrsio-r Sollner-Webb, 1981). As specific endoribonuclease, was shown not to produce one approach, our laboratory has isolated and characterized a similar cleavages in the +650 region, indicating that variety of ribonucleases from mouse nucleoli NaCI, 5 mM dithiothreitol, 10 units of RNasin, approximately 0.25 pg of transcript, and the designated number of units of nucleolar

RESULTS
Additions Preincubation
EGTRANase plus micrococcal nuclease
Eco R I
RNaisne Ribosomal R N A Processing
TATCTCGCTTGTTTCTCCCGATTGCGCGTCGTTGCTCACTCTTAGATCGATGTGGTGCTCCGG t
Findings
DISCUSSION
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call