Revelation of the ability of Burkholderia sp. USM (JCM 15050) PHA synthase to polymerize 4-hydroxybutyrate monomer

Nyok-Sean Lau,Kumar Sudesh

doi:10.1186/2191-0855-2-41

Abstract

The nutrition-versatility of Burkholderia sp. strain USM (JCM 15050) has initiated the studies on the use of this bacterium for polyhydroxyalkanoate (PHA) production. To date, the Burkholderia sp. has been reported to synthesize 3-hydroxybutyrate, 3-hydroxyvalerate and 3-hydroxy-4-methylvalerate monomers. In this study, the PHA biosynthetic genes of this strain were successfully cloned and characterized. The PHA biosynthetic cluster of this strain consisted of a PHA synthase (phaC), β-ketothiolase (phaA), acetoacetyl-CoA reductase (phaB) and PHA synthesis regulator (phaR). The translated products of these genes revealed identities to corresponding proteins of Burkholderia vietnamiensis (99–100 %) and Cupriavidus necator H16 (63–89%). Heterologous expression of phaCBs conferred PHA synthesis to the PHA-negative Cupriavidus necator PHB¯4, confirming that phaCBs encoded functionally active protein. PHA synthase activity measurements revealed that the crude extracts of C. necator PHB¯4 transformant showed higher synthase activity (243 U/g) compared to that of wild-types Burkholderia sp. (151 U/g) and C. necator H16 (180 U/g). Interestingly, the transformant C. necator PHB¯4 harbouring Burkholderia sp. PHA synthase gene accumulated poly(3-hydroxybutyrate-co-4-hydroxybutyrate) with 4-hydroxybutyrate monomer as high as up to 87 mol% from sodium 4-hydroxybutyrate. The wild type Burkholderia sp. did not have the ability to produce this copolymer.

Highlights

Since the introduction of phenoformaldehyde plastic in 1909 by Leo Hendrik Baekeland, petrochemical plastics have developed into a major industry and an indispensable commodity for modern life (Meikle, 1995)
Sequence comparisons and alignments were performed with the Construction of plasmids To construct a plasmid for expression of phaCBs in C. necator PHB4, polymerase chain reaction (PCR) was performed with primer pairs IV to obtain the gene fragment containing the putative coding region, ribosome binding site and promoter
USM (JCM15050), primers for amplification were designed based on the annotated phaC, phaA, phaB and PHA synthesis regulator (phaR) obtained from genomic DNA sequencing of Burkholderia vietnamiensis, Burkholderia thailandensis, Burkholderia ambifaria, Burkholderia glumae, Burkholderia mallei, Burkholderia multivorans and Burkholderia cenocepacia

Summary

Introduction

Since the introduction of phenoformaldehyde plastic in 1909 by Leo Hendrik Baekeland, petrochemical plastics have developed into a major industry and an indispensable commodity for modern life (Meikle, 1995). PHA synthases are the most important enzymes involved in PHA biosynthesis They can be grouped into four classes based on their in vivo substrate specificities, primary amino acid sequences and subunit composition (Rehm, 2007). Class І synthases, which are represented by the PHA synthase from Cupriavidus necator, are active towards short-chain length (R)-hydroxyacyl-CoA consisting of three to five carbon atoms (Pötter and Steinbüchel, 2006). Class IV PHA synthases, represented by the enzyme of Bacillus megaterium, consist of two different types of subunits (PhaC and PhaR). Both class ІІІ and IV PHA synthases prefer short-chain length (R)-hydroxyacyl-CoA. The accumulation of PHA containing 4HB monomer was not observed in wild-type Burkholderia sp. culture, the PHA synthase of Burkholderia sp. was able to polymerize the 4HB monomer

Materials and methods

F: GCGAGGATCCGAAAATGTTTTATGTT

Results