Abstract
This study aimed to elucidate how microRNA27a-3p (miR-27a-3p) modulates the Wnt/β-catenin signaling pathway to promote the epithelial-mesenchymal transition (EMT) in oral squamous carcinoma stem cells (OSCSCs) by targeting secreted frizzled-related protein 1 (SFRP1). Flow cytometry was used to sort OSCSCs from the SCC-9 and Tca8113 cell lines. The OSCSCs were randomly assigned into the miR-27a-3p inhibitors group, the miR-27a-3p inhibitors-NC group, the si-SFRP1 group, the si-SFRP1 + miR-27a-3p inhibitors group and the blank group. A luciferase reporter, immunofluorescence and Transwell assays were performed to detect luciferase activity, SFRP1, and cell migration and invasion, respectively. The mRNA expression of miR-27a-3p, SFRP1 and EMT markers (E-cadherin, N-cadherin, vimentin and ZEB1) were detected using qRT-PCR. The protein expression of SFRP1, EMT markers and the proteins of the Wnt/β-catenin signaling pathway was detected by Western blotting. OSCSCs showed up-regulated miR-27a-3p, Wnt/β-catenin signaling pathway-related proteins, vimentin, N-cadherin and ZEB1 and down-regulated SFRP1 and E-cadherin. MiR-27a-3p targeted SFRP1. Down-regulated miR-27a-3p resulted in increased E-cadherin and SFRP1 but decreased vimentin, N-cadherin, ZEB1, the Wnt/β-catenin signaling pathway-related proteins, and invasive and migratory cells. Silenced SFRP1 reversed this effect. We found that miR-27a-3p modulated the Wnt/β-catenin signaling pathway to promote EMT in OSCSCs by down-regulating SFRP1.
Highlights
F: GTCAGTTCAGACTCCAGCCC R: AAATTCACTCTGCCCAGGACG F: GGACAGCCTCTTCTCAATG RCTGCAGGCTCACTGCTCTC F: AAAGTGTGGCTGCCAAGAAC R: AGCCTCAGAGAGGTCAGCAA F: TGCACTGAGTGTGGAAAAGC R: TGGTGATGCTGAAAGAGACG
E the Wnt/β-Catenin Signaling L Pathway to Promote EpithelialC Mesenchymal Transition in Oral I Squamous Carcinoma Stem Cells by T Targeting SFRP1 R Bin Qiao1,2,*, Bao-Xia He3,*, Jing-Hua Cai[1], Qian Tao2 & Alfred King-yin Lam[1,4] A This study aimed to elucidate how microRNA27a-3p modulates the Wnt/β-catenin signaling pathway to promote the epithelial-mesenchymal transition (EMT) in oral squamous carcinoma stem cells (OSCSCs) by targeting secreted frizzled-related protein 1 (SFRP1)
The dual-luciferase reporter assay found that in SCC-9 and Tca8113 cells, miR-27a-3p mimics had no obvious effect on the luciferase activity in Mut-miR-27a-3p and SFRP1 plasmids; it caused the luciferase activity in wild type (Wt)-miR-27a-3p and SFRP1 plasmids to decrease by 60% and 80%, respectively (Fig. 6B,C)
Summary
CTGCAGGCTCACTGCTCTC F: AAAGTGTGGCTGCCAAGAAC R: AGCCTCAGAGAGGTCAGCAA F: TGCACTGAGTGTGGAAAAGC R: TGGTGATGCTGAAAGAGACG. Note: qRT-PCR, quantitative real-time polymerase chain I reaction; GAPDH, glyceraldehyde-3- phosphate dehydrogenase; SFRP1, secreted frizzled-related protein 1; ZEB1, zinc finger E-box binding homeobox 1; F, Forward; R, reverse. After washing 3 times with 0.01 mol/L PBS (5 min each time), the fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit IgG secondary antibody (Beijing Zhongshan Jinqiao Biological Technology Co., Ltd., Beijing, China) was added, and the samples were incubated at room temperature for 1 h. The cells were washed with PBS (0.01 mol/L) 3 times (5 min each time). Diamidino-2-phenylindole (DAPI) was added, and the cells were incubated at room temperature for 5 min, followed by PBS washing (0.01 mol/L) 3 times (5 min each time). The secondary antibody was added, the membranes incubated at room temperature for 1 h, and they were washed with TBST 3 times (10 min each time).
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have