Abstract

BackgroundPartial transection (PT) of the optic nerve is an established experimental model of secondary degeneration in the central nervous system. After a dorsal transection, retinal ganglion cells (RGCs) with axons in ventral optic nerve are intact but vulnerable to secondary degeneration, whereas RGCs in dorsal retina with dorsal axons are affected by primary and secondary injuries. Using microarray, we quantified gene expression changes in dorsal and ventral retina at 1 and 7 days post PT, to characterize pathogenic pathways linked to primary and secondary degeneration.ResultsIn comparison to uninjured retina Cryba1, Cryba2 and Crygs, were significantly downregulated in injured dorsal retina at days 1 and 7. While Ecel1, Timp1, Mt2A and CD74, which are associated with reducing excitotoxicity, oxidative stress and inflammation, were significantly upregulated. Genes associated with oxygen binding pathways, immune responses, cytokine receptor activity and apoptosis were enriched in dorsal retina at day 1 after PT. Oxygen binding and apoptosis remained enriched at day 7, as were pathways involved in extracellular matrix modification. Fewer changes were observed in ventral retina at day 1 after PT, most associated with the regulation of protein homodimerization activity. By day 7, apoptosis, matrix organization and signal transduction pathways were enriched. Discriminant analysis was also performed for specific functional gene groups to compare expression intensities at each time point. Altered expression of selected genes (ATF3, GFAP, Ecel1, TIMP1, Tp53) and proteins (GFAP, ECEL1 and ATF3) were semi-quantitatively assessed by qRT-PCR and immunohistochemistry respectively.ConclusionThere was an acute and complex primary injury response in dorsal retina indicative of a dynamic interaction between neuroprotective and neurodegenerative events; ventral retina vulnerable to secondary degeneration showed a delayed injury response. Both primary and secondary injury resulted in the upregulation of numerous genes linked to RGC death, but differences in the nature of these changes strongly suggest that death occurred via different molecular mechanisms.

Highlights

  • Traumatic injury to the central nervous system (CNS) is the direct damage of brain or spinal cord tissue by a physical insult

  • While endothelin converting enzyme-like 1 (Ecel1), Timp1, Mt2A and major histocompatibility complex (CD74), which are associated with reducing excitotoxicity, oxidative stress and inflammation, were significantly upregulated

  • Genes associated with oxygen binding pathways, immune responses, cytokine receptor activity and apoptosis were enriched in dorsal retina at day 1 after Partial transection (PT)

Read more

Summary

Background

Partial transection (PT) of the optic nerve is an established experimental model of secondary degeneration in the central nervous system. Retinal ganglion cells (RGCs) with axons in ventral optic nerve are intact but vulnerable to secondary degeneration, whereas RGCs in dorsal retina with dorsal axons are affected by primary and secondary injuries. We quantified gene expression changes in dorsal and ventral retina at 1 and 7 days post PT, to characterize pathogenic pathways linked to primary and secondary degeneration

Results
Conclusion
Introduction
Experimental procedures
F: CTGGACGACAGGCAGACTTT R
PTD-D1 D7 PTV-D1 D1 PTV-D1 D7 PTV-D7
Discussion
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call