Abstract
PurposeArgonaute proteins are key players in small RNA-guided gene silencing processes. Ago2 is the member of the Argonaute subfamily with slicer endonuclease activity and is critical for microRNA homeostasis and indispensable for biological development. However, the impact of Ago2 dysregulation in the retina remains to be fully explored. In this study, we studied the role of Ago2 in mouse retina.MethodsWe explored the function of Ago2 in the mouse retina through an adeno-associated virus-mediated Ago2 disruption mouse model. An ERG was carried out to determine the retinal function. Spectral domain optical coherence tomography, fundus photographs, and immunostaining were performed to investigate the retinal structure. A quantitative RT-PCR assay was used to determine the expression of noncoding RNAs.ResultsBoth silencing and overexpression of Ago2 in mouse retina resulted in significant retinal morphological alterations and severe impairment of retinal function, mainly with a thinned outer nuclear layer, shortened inner segment/outer segment, and diminished ERG responses. Furthermore, Ago2 disruption resulted in alterations of noncoding RNAs in retina.ConclusionsOur finding demonstrated that Ago2 interruption led to severe retinal degeneration, suggested that Ago2 homeostasis contributed to retinal structural and functional maintenance.
Highlights
As types of small RNAs, microRNAs, short interfering RNAs and PIWI-interacting RNAs typically assemble with Argonaute proteins into the RNA-induced silencing complex (RISC).[1,2,3]
We found that Ago[2] disruption led to severe retinal degeneration, including shortened inner segment/outer segment (IS/OS), thinned outer nuclear layer (ONL), and impaired ERG response
We found that the retina displayed a thinner IS/OS, ONL, and whole retina, whereas the inner nuclear layer (INL) seemed to be unaffected after Ago[2] removing (Figs. 2A, B and Supplementary Fig. S3)
Summary
We explored the function of Ago[2] in the mouse retina through an adenoassociated virus-mediated Ago[2] disruption mouse model. An ERG was carried out to determine the retinal function. The silencing and overexpression of Ago[2] in mouse retina has been achieved through subretinal injection of AAV-shAgo2-EGFP and AAV-Ago2-3Flag vectors. To generate the AAV-shAgo2-EGFP, the target sequence GCACACGCTCTGTGTCAAT was cloned into the GV478 vector containing pU6-MCS-CAG-EGFP. To generate AAV-Ago23Flag, the target Ago[2] sequence (2622 bp) was amplified by primer TACCGGACTCAGATCTCGAGATGTACTCGGGAGCCGGCCCCGTTC and GATCCCGGGCCCGCGGTACCGTAGCAAAGTACATGGTGCGCAGTGTG, the PCR product was cloned into the Xho I and Kpn I sites of a GV411 vector containing pCMV-betaGlobin-MCS-3Flag-SV40 PolyA
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
