Reply to Donnelly

Abstract

To the Editor:Donnelly comments, in his letter, on the confusing numbering used for the nomenclature of the second single-nucleotide polymorphism (SNP) discovered in the methylenetetrahydrofolate reductase (MTHFR) gene (Van der Put et al. 1998xA second common mutation in the methylenetetrahydrofolate reductase gene: a risk factor for neural-tube defects?. van der Put, NMJ, Fons, G, Stevens, EMB, Smeitink, JAM, Trijbels, FJM, Eskes, TKAB, van den Heuvel, LP et al. Am J Hum Genet. 1998; 62: 1044–1051Abstract | Full Text | Full Text PDF | PubMed | Scopus (1101)See all References1998). We agree that the numbering that was used may be confusing for two reasons.First, we designated this SNP as the “1298(A→C) mutation,” by use of the same numbering method used to indicate the 677(C→T) substitution, the first SNP discovered in the MTHFR gene (Frosst et al. 1995xA candidate genetic risk-factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Frosst, P, Blom, HJ, Milos, R, Goyette, P, Sheppard, CA, Matthews, RG, Boers, GJH et al. Nat Genet. 1995; 10: 111–113Crossref | PubMedSee all References1995). Although this SNP is designated to be at position 677, the actual location of this SNP may be at position 665 of the coding region, if numbering is started at the first ATG site of the reported coding sequence (Goyette et al. 1994xHuman methylenetetrahydrofolate reductase: isolation of cDNA, mapping and mutation identification. Goyette, P, Sumner, JS, Milos, R, Duncan, AMV, Rosenblatt, DS, Matthews, RG, and Rozen, R. Nat Genet. 1994; 7: 195–200Crossref | PubMed | Scopus (62)See all References1994). Thus, discrepancies in numbering started before the discovery of the second SNP. We therefore had two options for determining the nomenclature of the second SNP in the MTHFR gene: either to start numbering at the ATG or to use the method of numbering that is in concordance with that used for the first SNP. In our opinion, this last option would be more reasonable, because of the widely accepted nomenclature of the 677(C→T) substitution. Therefore, we designated the second SNP as the “1298(A→C) mutation.”Second, the sequence reported by Goyette et al. (1994xHuman methylenetetrahydrofolate reductase: isolation of cDNA, mapping and mutation identification. Goyette, P, Sumner, JS, Milos, R, Duncan, AMV, Rosenblatt, DS, Matthews, RG, and Rozen, R. Nat Genet. 1994; 7: 195–200Crossref | PubMed | Scopus (62)See all References1994) unfortunately contained a C at the 1298 sequence, instead of at the much more common 1298A sequence, of the MTHFR gene. We have no doubt that the mutation is an A→C, rather than a C→A, transition, which is clearly reflected by the prevalence of the 1298 SNP and its effect on MTHFR activity (van der Put et al. 1998xA second common mutation in the methylenetetrahydrofolate reductase gene: a risk factor for neural-tube defects?. van der Put, NMJ, Fons, G, Stevens, EMB, Smeitink, JAM, Trijbels, FJM, Eskes, TKAB, van den Heuvel, LP et al. Am J Hum Genet. 1998; 62: 1044–1051Abstract | Full Text | Full Text PDF | PubMed | Scopus (1101)See all References1998).Additionally, we would like to describe an improved method of PCR/RFLP screening for the 1298 SNP. By use of two PCR primers—forward primer ATGTGGGGGGAGGAGCTGAC and the intronic reverse primer GTCTCCCAACTTACCCTTCTCCC—a 241-bp fragment will be obtained. If the wild-type genotype (1298AA) is present, then the MboII RFLP results in two fragments—one that is 204 bp and one that is 37 bp. For the homozygous mutated MTHFR genotype (1298CC), only the 241-bp fragment is obtained, and, for the heterozygous genotype, all three fragments are obtained. These RFLP fragments can be easily differentiated by means of agarose-gel electrophoresis.We examined the possible interference of the 1317(T→C) transition with the proper screening of the 1298 SNP. 1317(T→C) is a silent mutation (Weisberg et al. 1998xA second genetic polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with decreased enzyme activity. Weisberg, I, Tran, P, Christensen, B, Sibani, S, and Rozen, R. Mol Genet Metab. 1998; 64: 169–172Crossref | PubMed | Scopus (864)See all References1998) that, like the 1298 SNP, results in the formation of an MboII recognition site and that could thus disturb genotyping of 1298. We performed restriction-enzyme analysis with MboII and BpuAI—the latter restriction enzyme recognizes only the 1317(T→C) substitution—on the PCR-obtained 241-bp fragment and looked for possible misinterpretation of the 1298 genotype. The 1317CC genotype was not observed among 450 Dutch individuals, and we observed only 3 heterozygous individuals, which resulted in the 1317C allele having a frequency of .003 among the Dutch population. The 1317 SNP did not interfere with the proper genotyping of 1298; in all three cases, the 1317C allele was present on a 1298A allele, which already results in a MboII recognition site. Possibly, the 1317C substitution arose at the 1298A allele and, thus, will not disturb genotyping of 1298.