Abstract
The aspartate residue of the (N/T)KXD concensus sequence for GTP-binding proteins is present in the eight available sequences of adenylosuccinate synthetase. Reported here is a comprehensive analysis of the substrate specificity of mutant enzymes, where the conserved Asp333 of the synthetase from Escherichia coli is changed to asparagine, glutamate, and glutamine by site-directed mutagenesis. The mutants D333N, D333E, and D333Q generally show decreased kcat values and increased Km values for GTP. The decreased values of kcat exhibited by the mutants indicate that the interactions between Asp333 and the guanine are relayed by some mechanism to the catalytic residues around the gamma-phosphate of GTP, and that the energy provided by the interaction between Asp333 and the guanine moiety of GTP is utilized for rearrangement of the catalytic residues. The three mutants each have higher affinity for xanthosine 5'-triphosphate (XTP) and ITP than does the wild-type enzyme. In fact, the D333N mutant uses XTP more effectively than the wild-type enzyme employs GTP as a substrate. The side-chain of Asp333 forms hydrogen bonds with the N-1 and the exocyclic amino group of the guanine base of GTP. In the D333N mutant, this interaction is probably replaced by hydrogen bonds between the amide side chain of Asn333 and N-1 and the 2-oxo group of XTP. The D333Q mutant can use UTP as a substrate more effectively than the wild-type enzyme. The longer side chain of glutamine at residue 333 favors pyrimidine nucleotides over the purine nucleotides, GTP, XTP, and ITP. These results demonstrate that Asp333 in the (N/T)KXD consensus sequence of adenylosuccinate synthetase from E. coli is a determinant for GTP-specificity.
Highlights
Ported here is a comprehensive analysiosf the substrate This is the first reaction committed to the formationof AMP specificity of mutant enzymes,where the conserved Aspgss otfhe synthetasefromEscherichia coliis changed to asparagine, glutamate, and glutamine by site-directed mutagenesis.The mutants D333N,D333E, and D333Q generallyshowdeceased kc, values and increased ICm values for GTP
The longerside from E. coli suggests that the carboxylate group ofAsp333in the (N/T)KXD consensus sequence interacts with the C-2 exocyclic amino group anda hydrogen atom of the N-1 endo-nitrogen of the guanine basoef GTP
The catalytic power of enzymes is explained by the stabilization of the transition stawtehich is brought abobuyt utilizing the potential binding energoyf substrates [1].Progress toward understanding the originsof substrate specificity is shown by several successes in altering thespecificities of some enzymes hydrolyzing enzyme
Summary
5'-CCAGAACCTCCAGTTTAGTC 5' CCAGAACCTGCAGTTTAGTC a The mismatched bases are shown ibnoldface. The experimental details for these procedures are described elsewhere[17]. The concentration of the purified proteins in solution was determined using the extinctioconefficient for wild-type AMPSaseat 280 nm (ezso= 67.85 m"'cm"), where the concentration refers to monomers. AMPSase activity was determined as described earlier [24], except that the absorbance acth2a8n9gnem was monitored. The concentrationsof the stock solutionsof the nucleotides were determined using their extinctiocnoefficients at theproper wavelengths. The procedure used in this study was similar to that previously described [17]. The protein concentration w0a.s10-0.15mg/ ml, and the spectra were normalized for direct comparison. WDifference Spectra-At different timesW , spectra of the reaction mixtures were taken with proper amouonftsthe AMPSases and nucleotides using a Hewlett Packard Diode Array W Spectrophotometer (model HP 8452A).
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
