Regulatory sequences on the human villin gene trigger the expression of a reporter gene in a differentiating HT29 intestinal cell line

S Robine,C Sahuquillo-Merino,D Louvard,E Pringault

doi:10.1016/s0021-9258(18)82141-x

Abstract

To develop a molecular tool for tissue-specific targeting of gene expression in immature and differentiated epithelial cells of the small and large intestinal mucosa, we have isolated the 2-kb 5'-flanking region of the human villin gene. This region contains numerous short sequences that are conserved among other tissue-specific promoters of genes expressed in differentiated enterocytes. This DNA fragment promotes the transcription and expression of the luciferase reporter gene in villin-positive intestinal, renal, and hepatoma cell lines but not in a villin-negative keratinocyte cell line. The pattern of expression corresponds that of the endogenous gene, indicating that this sequence can direct intestine-specific transcription. In the differentiating HT29 intestinal cell line, expression of the reporter gene is already detectable in undifferentiated cells, and dramatically increases when terminal differentiation is induced. Thus, as previously reported for the endogenous gene the isolated 5'-flanking region of the villin gene responds positively to conditions known to stimulate terminal differentiation of these cultured epithelial intestinal cells. The reported results indicate that this genomic fragment contains sufficient regulatory elements to recapitulate the expression pattern of the villin promoter during intestinal differentiation.

Highlights

RESULTSStructure of the 5’-Flanking Region of theHumanVillin Gene-To isolate 5”flanking sequences from the villin gene, pig LLCPKl renal cell line derived from proximal tubule of the we started with the previously isolated EMBL3-85e recombikidney (Rabito et al, 1984), and the SKP keratinocyte line derived nant bacteriophagewhich has beenused to elucidatethe from human penile carcinoma. Cellswere transfected using a lipofusion reagent (Bethesda Research Laboratories) to induce the formation of lipid-DNA complexes (Felgner et al, 1987)
Regulatory Sequences on the Human Villin Gene Trigger the Expression of a Reporter Genien a Differentiating HT29 Intestinal Cell Line*
In the differentiating HT29 intestinal cell line, expression of the reporter gene is already detectable in undifferentiated cells, and dramatically increases when terminal differentiation is induced

Summary

RESULTS

Structure of the 5’-Flanking Region of theHumanVillin Gene-To isolate 5”flanking sequences from the villin gene, pig LLCPKl renal cell line derived from proximal tubule of the we started with the previously isolated EMBL3-85e recombikidney (Rabito et al, 1984), and the SKP keratinocyte line derived nant bacteriophagewhich has beenused to elucidatethe from human penile carcinoma. Cellswere transfected using a lipofusion reagent (Bethesda Research Laboratories) to induce the formation of lipid-DNA complexes (Felgner et al, 1987). CaCOZ,HT29, andSKP cells weregrown to approximately 50% Resultant heteroduplexes were digested wiSth nuclease, and confluency before transfection by procedure identical to thatused for protected fragments were analyzed onan acrylamide gel Initiation site (tothe bold underlined cytosine residue in the Briefly, epithelial cells were scraped (48 hafter transfection for sequence CCTTCTCCCCCAGGCTCACTCACCATGACC). Mediated regulation of villin gene activity have been demonstratedinculturedcells.as is the case with the majority of epithelial cells, i n vivo terminal differentiation of the intestine mucosa might depend on glucocorticoid stimulation. These steroid hormone response elements could be. -1895 GATCA TCGAmAGT TAACCCCCTA AGTTGACCCC CTCAGCTCAT AGATGAAGAA GGGAAGTCTA CGTTCATACA GCTAGTGAGT GTCAAAGAAA

G GACAGAGACA AAGGTGATGA CAGAAATGAA ACAGAAAACG GTCTCCTCCT TTATACCCCA ACCTGGTTCT

TCCCCCAGGCTCACTCACC

C C C C q T

DISCUSSION