Abstract

Intrоduction.Human antigen PRAME is preferentially expressed in a number of different tumor types and may be a potent target for anti-tumor immunotherapy.Purpose.To study anti-tumor action of immunogenic mix recombinant PRAME protein and adjuvant in mice with innate immunity.Materials and methods.C57BL/6 female mice were used for immunization with purified human recombinant protein PRAME. Human PRAME gene coding sequence was cloned in mammalian expressing vector pCEP4 and resulting plasmid was introduced in mouse melanoma B16F10 cells by transfection followed by RQ-PCR, Western blot and flow-cytometry analysis. Then stably PRAME-transfected melanoma cells were injected in mice.Results.The mouse melanoma B16F10 cells stably expressing human PRAME protein were obtained. We demonstrate the 10-fold decreased tumor volume in mice with melanoma B16F10 expressing human PRAME after preventive immunization series with recombinant PRAME protein. The tumor volume reducing was correlated with high titer (6.14 × 10 5) of anti-PRAME antibodies in mice sera.Conclusion.These data indicate that recombinant protein PRAME is immunogenic and may be a potent antigen for immunotherapuetics studies.

Highlights

  • C57BL/6 female mice were used for immunization with purified human recombinant protein PRAME

  • Human PRAME gene coding sequence was cloned in mammalian expressing vector pCEP4 and resulting plasmid was introduced in mouse melanoma B16F10 cells by transfection followed by RQ-PCR, Western blot and flow-cytometry analysis

  • Stably PRAME-transfected melanoma cells were injected in mice

Read more

Summary

Оригинальные статьи

ИММУНИЗАЦИЯ РЕКОМБИНАНТНЫМ БЕЛКОМ PRAME ЗАМЕДЛЯЕТ РОСТ PRAME-ЭКСПРЕССИРУЮЩЕЙ ОПУХОЛИ У МЫШЕЙ. RECOMBINANT HUMAN PRAME IMMUNIZATION REDUCES PRAME-EXPRESSING TUMOR GROWTH IN MICE. To study anti-tumor action of immunogenic mix recombinant PRAME protein and adjuvant in mice with innate immunity. C57BL/6 female mice were used for immunization with purified human recombinant protein PRAME. Human PRAME gene coding sequence was cloned in mammalian expressing vector pCEP4 and resulting plasmid was introduced in mouse melanoma B16F10 cells by transfection followed by RQ-PCR, Western blot and flow-cytometry analysis. The mouse melanoma B16F10 cells stably expressing human PRAME protein were obtained. We demonstrate the 10-fold decreased tumor volume in mice with melanoma B16F10 expressing human PRAME after preventive immunization series with recombinant PRAME protein. These data indicate that recombinant protein PRAME is immunogenic and may be a potent antigen for immunotherapuetics studies

РОССИЙСКИЙ БИОТЕРАПЕВТИЧЕСКИЙ ЖУРНАЛ Russian journal of biotherapy
GACTCTTTATTTTTTCCTTAGA prmRb
Дни после трансплантации опухоли
Дни после трансплантации клеток меланомы
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.