Abstract
BackgroundGenetic experiments have clarified that p63 is a key transcription factor governing the establishment and maintenance of multilayered epithelia. Key to our understanding of p63 strategy is the identification of target genes. We perfomed an RNAi screening in keratinocytes for p63, followed by profiling analysis.ResultsC/EBPδ, member of a family with known roles in differentiation pathways, emerged as a gene repressed by p63. We validated C/EBPδ as a primary target of ΔNp63α by RT-PCR and ChIP location analysis in HaCaT and primary cells. C/EBPδ is differentially expressed in stratification of human skin and it is up-regulated upon differentiation of HaCaT and primary keratinocytes. It is bound to and activates the ΔNp63 promoter. Overexpression of C/EBPδ leads to alteration in the normal profile of p63 isoforms, with the emergence of ΔNp63β and γ, and of the TA isoforms, with different kinetics. In addition, there are changes in the expression of most p63 targets. Inactivation of C/EBPδ leads to gene expression modifications, in part due to the concomitant repression of ΔNp63α. Finally, C/EBPδ is found on the p63 targets in vivo by ChIP analysis, indicating that coregulation is direct.ConclusionOur data highlight a coherent cross-talk between these two transcription factors in keratinocytes and a large sharing of common transcriptional targets.
Highlights
Genetic experiments have clarified that p63 is a key transcription factor governing the establishment and maintenance of multilayered epithelia
We performed RNAi inactivation of p63 in human HaCaT cells followed by gene expression profiling with the Affymetrix platform [19]; one of the genes that was increased under these conditions was C/EBPδ
Upon p63 inactivation, a strong increase was obeserved for C/EBPδ, but not for C/EBPα, while C/EBPβ showed a modest increase (Fig. 1A). β-actin, an invariant mRNA, was used to normalize samples. ∆Np63 was decreased, as expected (Fig. 1A)
Summary
Cells and culture conditions First passage primary human keratinocytes -KCs- were derived from breast of healthy individuals and grown on a feeder-layer of lethally irradiated 3T3 cells in DMEM F12 added of Insulin (5 μg/ml), EGF-R (10 ng/ml) hydrocortisone (0.4 μg/ml), T3 (2 nM), Cholera toxin (0.1 nM) and transferrin (5 μg/ml). HaCaT were grown in DMEM or in low calcium medium when assayed for differentiation, which was added with 1.4 mM CaCl2 in 0.1% serum conditions. Primary KCs were differentiated by adding CaCl2 (1.4 mM final concentration) in the presence of 10% foetal calf serum. RT-PCR and transfections HaCaT cells were transiently trasfected using Oligofectamine or Lipofectamine 2000 (Gibco-BRL, USA) for 3 hours with 150 ng/cm of human p63 siRNA oligonucleotide (ACAATTTCATGTGTAACAGCA) which targets aminoacids 265–272 in the central DNA-binding domain of p63. RNA was extracted from HaCaT cells using an RNA-Easy kit (Qiagen). 2.5 ×
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
