Abstract

BackgroundMany of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max) genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS). Here the aim was to use BAC end sequences (BES) derived from three minimum tile paths (MTP) to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches.ResultsResults show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs) were single nucleotide polymorphisms (SNPs; 89%) and single nucleotide indels (SNIs 10%). Larger indels were rare but present (1%). Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed.ConclusionThe use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de-convolution and positioning of sequence scaffolds (see BES_scaffolds section of SoyGD). This approach will assist genome annotation for paleopolyploid and true polyploid genomes such as soybean and many important cereal and fruit crops.

Highlights

  • Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation

  • The comparison of Forrest and Williams 82 sequences represents a powerful tool for soybean geneticists

  • There are abundant single nucleotide polymorphism between alleles (SNP) and single nucleotide insertion (SNI) among the sequences, with many linked to predicted gene sequences (Table 1)

Read more

Summary

Results

Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs) were single nucleotide polymorphisms (SNPs; 89%) and single nucleotide indels (SNIs 10%). Larger indels were rare but present (1%). Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed

Conclusion
Background
Results and discussion
61 GGGTTAAGC-TTATAGGGAAGGACACAGGTCTTGGCTGGGATGGGGAGAAGAAAACCATT 119
Methods
Lightfoot DA: Soybean Genomics
Bashir R
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call