Rat aldolase isozyme gene.

K Tsutsumi,T Mukai,S Hidaka,H Miyahara,R Tsutsumi,T Tanaka,K Hori,K Ishikawa

doi:10.1016/s0021-9258(18)32445-1

Abstract

Rat aldolase B mRNA was partially purified from liver polysomes by an immunochemical technique followed by oligo(dT)-cellulose column chromatography. Double-stranded cDNA, synthesized from this mRNA, was inserted into the PstI site of plasmid pBR322 employing the oligo(dC)-oligo(dG) tailing method. Clones containing aldolase B cDNA inserts were selected by colony hybridization using 32P-labeled purified mRNA as a specific probe. Several recombinant plasmids containing 600 to 1000 base pair inserts were isolated. Hybrid selection-translation experiments showed that they hybridize specifically with aldolase B mRNA. By overlapping restriction maps of several individual cDNA inserts, it was found that they spanned 1200 base pairs, which represented about 70% of the aldolase B mRNA sequence. The nucleotide sequence of the cDNA was then determined and the sequence of 180 amino acids from the COOH terminus and the entire 3' untranslatable nucleotide sequence were clarified. Although the complete amino acid sequence of rat aldolase B has not yet been reported, it was found that several amino acids neighboring the COOH-terminal tyrosine obtained by carboxypeptidase digestion completely coincided with those determined from the cDNA sequence; i.e. -Ser-Leu-Phe-Thr-Ala-Ser-Tyr-Thr-Tyr. Furthermore, a putative active site peptide appeared and is extensively homologous to those of rabbit aldolases A and B.

Highlights

From the $Department of Biochemistry, Yamagata University School of Medicine, Yamagata 990-23 and the §Department of Biochemistry, Saga Medical School, Saga 840-01,Japan
Clones containing aldolase B cDNA inserts were selected by colony hybridization using 32P-labeledpurified mRNA as a specific probe
Poly(A) RNA was isolated from these specific polysomes by oligo(dT)cellulose column chromatography and used for the synthesis of single- and double-stranded cDNAs

Summary

RESULTS

Purification and Characterization of Aldolase B mRNAAldolase B mRNA was purified essentially as reported previously [7]. Analysis of the total translatiopnroducts synthesized by the mRNA at thispurification step in a reticulocyte lysate system showed that a major in uitro product co-migrated with marker aldolase B subunit on SDS-polyacrylamide gel (Fig. 1, lanes I and 2). Hybridized RNAs were eluted from the papers translation products from the above mRNAs was precipitated by anti-aldolase B antibodyb,ut the amounptrecipitated from the control (pBR322-filter) reaction mixturweas considerably lower From these results, it is apparent that the mRNAs eluted from the recombinant plasmid DNA-bound filters were and subjected to translation in the reticulocyte lysate system containing [?3]methionine. The orientation of inserted cDNAs relative to 3' and 5' ends of aldolase B mRNA was determined by Messenger RNAs in the poly(A) RNA fraction from rat liver polysomes were hybridized to recombinant plasmids, eluted, and translated in the reticulocyte system as described in the legend to Fig. 3.

I IIII IIIIII

DISCUSSION

C CTT G d ACCCTGCTAAAGCCAAACATGCTG