Abstract

A procedure for the purification of RNA polymerase from vegetative cells of the filamentous cyanobacterium Anabaena 7120 is described. Polyethyleneimine precipitation followed by gel filtration and affinity chromatography steps results in greater than 99% purification with 46% yield. The enzyme has a novel core component of Mr = 66,000, designated gamma, in addition to the typical prokaryotic beta'beta alpha 2 core enzyme. The sigma subunit has been identified by reconstitution of specific transcriptional activity from core enzyme and gel-purified sigma. In transcription assays, this RNA polymerase initiates at a number of Anabaena vegetative cell promoters, as well as from a bacteriophage T4 early promoter, but does not initiate at nitrogen fixation (nif) promoters used in heterocysts. The promoter specificity of Anabaena RNA polymerase is compared with that of Escherichia coli RNA polymerase.

Highlights

  • Starved for reduced nitrogen ( 5 )

  • Anabaena isone of thefilamentouscyanobacteriathat differentiate specializedcells,called heterocysts, at regular intervalsalongeachfilament inresponse to starvation for to understand that control, we have characterized RNA polymerase fromAnabaena vegetative cellsgrown with ammonia as thesource of fixed nitrogen

  • Analysis of protein synthesis in differentiating heterocysts has shown that there are many sets of GTP, UTP, 0.125 mM ATP, [8-3H]ATP (5X lo4cpm/nmol), and 50 pg/mlchicken erythrocyteDNA.RNAsynthesis was initiated by addition of 5 p1 of a n enzyme fraction followed by incubation at 37 “C for 10 min

Read more

Summary

RESULTS

Purification and Determinationof Subunit Structure-The polyacrylamide gel containing 1.25 mg of a Bio-Rex 70 holoenzyme procedureused to purify Anabaena RNA polymerase compool and renatured as described [9]. A high speedspin toclear many of the photosynthetic membranesfrom the cell lysate was an Sepharose step of the same method describedfor Anabaena RNA important step in purification of RNA polymerase from Anpolymerase This yielded 450 pg of enzyme of >99% purity. Gels stained with Coomassie Blue were first fixed for 15 min ibration with bufferA containing 200 mM KC1 resulted in more reproducible elution of the enzyme. At this point in the preparation, the protelianbseled as p', p, y,U , and O( in Fig. 2 had all co-eluted, in unchanging ratios, with RNApolymerase activity.

Volume Total Total Sacpteicviiftiyc Yield'
DISCUSSION
RNA polymerases
The Anabaena glnA gene seems to have multiple promoters
AAACAATCTA WACTT AAGGATTTTATGTCAAAGTTGACCCCTATGAGATTAACTT
TGTAAGTTAAGAACTTTTCA AAWCT TATGCCATTTCTTGATATAT TGAGAGACAA
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call