Protocatechualdehyde Inhibits the Osteoclast Differentiation of RAW264.7 and BMM Cells by Regulating NF-κB and MAPK Activity.

Yunyun Qu,Huanxin Sun,Shuai Zong,Xin Liu,Yueran Zhao,Shuang Liu,Min Tang

doi:10.1155/2021/6108999

Abstract

Protocatechualdehyde (PCA), an important component of Salvia miltiorrhiza, has many activities, such as anti-inflammatory and antisepsis activities. However, the role of PCA in osteoclasts is not clear. We used RAW264.7 cells (a mouse leukemic monocyte/macrophage cell line) and bone marrow macrophages (BMMs) to probe the role of PCA in osteoclasts and the underlying mechanism. The effects of PCA on cell activity were evaluated with CCK-8 assays. TRAP staining detected mature osteoclasts. Corning Osteo Assay Surface plates were used to examine absorption. The levels of RNA and protein were analyzed, respectively, using RT-PCR and Western blotting. PCA (5 μg/ml) was not toxic to the two cell types but reduced the formation of osteoclasts and bone absorption. Furthermore, PCA restrained the expression of mRNAs encoding proteins associated with osteoclasts and reduced the phosphorylation of proteins in important signaling pathways. The results indicate that PCA inhibits osteoclast differentiation by suppressing NF-κB and MAPK activity.

Highlights

Osteoporosis is a degenerative disease with an increasing risk due to aging and is one of the most common diseases in older men [1]
PCA Attenuates Osteoclast Differentiation Induced by RANKL
bone marrow macrophages (BMMs) and RAW264.7 cells were successfully induced to differentiate into osteoclasts by RANKL

Summary

Introduction

Osteoporosis is a degenerative disease with an increasing risk due to aging and is one of the most common diseases in older men [1]. Bisphosphonates are common agents used to treat osteoporosis and significantly inhibit the activity of osteoclasts. They have been recommended by many authoritative institutions worldwide due to their clear efficacy [3]. Salvianolic acid B is a water-soluble extract of SM PCA significantly improves bone physical indexes, increases bone density and the levels of bone minerals and organic matter, increases the ratio of important organs, and effectively prevents the occurrence of osteoporosis caused by prednisone acetate in the growth period of rats [11]. PCA has important theoretical significance and clinical application value in the search for economical and effective drug monomers to treat osteoporosis

Materials and Methods

F: GGGGACTTATGTGTTTCCACG

Results

Discussion