Abstract
We have devised a combined in vivo, ex vivo, and in vitro approach to elucidate the mechanism(s) responsible for the hypoalphalipoproteinemia in heterozygous carriers of a naturally occurring apolipoprotein A-I (apoA-I) variant (Leu(159) to Arg) known as apoA-I Finland (apoA-I(FIN)). Adenovirus-mediated expression of apoA-I(FIN) decreased apoA-I and high density lipoprotein cholesterol concentrations in both wild-type C57BL/6J mice and in apoA-I-deficient mice expressing native human apoA-I (hapoA-I). Interestingly, apoA-I(FIN) was degraded in the plasma, and the extent of proteolysis correlated with the most significant reductions in murine apoA-I concentrations. ApoA-I(FIN) had impaired activation of lecithin:cholesterol acyltransferase in vitro compared with hapoA-I, but in a mixed lipoprotein preparation consisting of both hapoA-I and apoA-I(FIN) there was only a moderate reduction in the activation of this enzyme. Importantly, secretion of apoA-I was also decreased from primary apoA-I-deficient hepatocytes when hapoA-I was co-expressed with apoA-I(FIN) following infection with recombinant adenoviruses, a condition that mimics secretion in heterozygotes. Thus, this is the first demonstration of an apoA-I point mutation that decreases LCAT activation, impairs hepatocyte secretion of apoA-I, and makes apoA-I susceptible to proteolysis leading to dominantly inherited hypoalphalipoproteinemia.
Highlights
Cholesterol (HDL-C) are inversely correlated with the risk of developing coronary heart disease [1]
This is attributed to the intricate nature of high density lipoprotein (HDL) metabolism that involves many components including the major HDL structural protein apolipoprotein A-I and multiple factors required for cholesteryl ester (CE) formation, lipolysis, lipid transfer, cellular lipid efflux, and cell surface interactions
Pfu, plaque-forming units; TC, total cholesterol; PAGGE, polyacrylamide gradient gel electrophoresis; Murine apoA-I (mapoA-I), murine apoA-I; FBS, fetal bovine serum; m.o.i., multiplicity of infection; Dulbecco’s minimal essential medium (DMEM), Dulbecco’s modified minimal medium; rec.human apoA-I (hapoA-I), His-tagged purified recombinant hapoA-I; rec.apoA-IFIN, His-tagged purified recombinant apoA-IFIN; Lp2A-I, reconstituted lipoproteins containing two molecules of apoA-I; POPC, 1-palmitoyl-2-oleoylphosphatidylcholine; BSA, bovine serum albumin; Lp2A-IWT, Lp2A-I with two molecules of hapoA-I; Lp2A-IFIN, Lp2A-I with two molecules of apoA-IFIN; Lp2A-IWT/FIN, Lp2A-I containing two apoA-I prepared with an equimolar amount of hapoA-I and apoA-IFIN; pCPT-cAMP, cAMP analog 8-(4-chlorophenylthio)-cAMP; apoA-II, apolipoprotein A-II
Summary
Mutagenesis of ApoA-I cDNA—The apoA-IFIN cDNA was generated by the QuikChangeTM mutagenesis protocol from Stratagene (La Jolla, CA) with sense 5ЈGTGGACGCGCGGCGCACGCATC3Ј and antisense 5ЈGATGCGTGCGCCGCG-CGT3Ј primers (Life Technologies, Inc.). The initial rate constants apparent Km (appKm) and Vmax were calculated by incubating the Lp2A-I at the concentrations indicated (given as M of apoA-I) with the enzyme for 10 min at 37 °C and terminating the reaction with the addition of 2 ml of ethanol Under these conditions, there is minimal substrate conversion as documented previously [28]. The time course of CE formed was followed over 5 h by incubating Lp2A-I particles at a final apoA-I concentration of 2.0 M with 3.5 units of LCAT For both sets of experiments, the values are the mean (Ϯ S.E.) of triplicate measurements and represent the average of two independent experiments. Cholesterol was allowed to equilibrate with the cells for 10 –12 h at which time the medium was removed and replaced with DMEM/BSA with or without pCPT-cAMP containing rec.hapoA-I or rec.apoA-IFIN as lipid-free proteins or as Lp2A-I (1.7 M final apoA-I concentration). Efflux was measured over 3 h after subtracting the basal 3H-FC efflux to medium of cells without apoA-I (DMEM/BSA control) which was less than 10% of the apoA-I-specific efflux
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
