Abstract

Two kilobase segments of the 5'-untranslated regions of the human and rabbit butyrylcholinesterase (BCHE) genes were characterized. The sequences shared extensive identity except for a 333-base pair (bp) Alu repeat present only in human BCHE. One single transcription start site was found in both genes with the techniques of primer extension, amplification of the 5'-end of mRNA, and RNase protection. Cap sites in human and rabbit BCHE genes were found in strictly homologous positions. In human BCHE, the transcription start site was found 157 bp upstream of Met-28, the translation start site. Potential regulatory elements in both promoters included one AP1 site and multiple sites for topoisomerase, Oct-1 and PEA-3. Transient expression of BCHE-reporter gene constructs showed that a 194-bp fragment of the 5'-flanking region of human BCHE and a 570-bp fragment of rabbit BCHE were sufficient for promoting chloramphenicol acetyltransferase activity in HeLa cells. No consensus TATA and CAAT boxes were found. However, the sequence around the transcription start site exhibited homology with initiator elements found in other TATA-less promoters in developmentally regulated genes.

Highlights

  • BCHE genes were found in strictly homologous posimost tissues than ACHE mRNA, except in brain and muscle ftsarioniiesotuecpen,lnoO.usdr.PdctI1eoten-5drt1e7hangobnutenpdimnaePAuleaEprPnescA1tgBor-sun3eCilat.saTHetmtrroaEuaornc,nyfdttssehielmeM ensmhttuereolexatwPnpnipter,sslecdetsrshsiiiepittnohettnisarobotafnoofnBtrasshCtlaatp1Hortr9itpooE4somni--tibsesopottwamearrfertssra-gmwyleinofehDeudnernurtaoegrftieiAnnmsgCtgitsHoenosEmmeisubmi,rrtaeyRwlsoNhnbteAiiocrsdetsihseauvsiemnesABlo,ocCrChpehihmcEaEkebenpsuntryBnon(dCd1tauhh0nceE)ttsiia(os7nn-id9ssi)srst.aawbrditbtesctihetw(ec1hdte1eodn)f.fIinnanetupttrrhhooee

  • Transcription start site revealed that the BCHE promoter in both man and rabbiits rich in A + T

  • The coding region of BCHE is rich in A + T, containing 62% A + T.No typical TATA or CAAT boxes were regions of human and rabbitBCHE genes and gives a preliminary functional analysis of their promoter activity

Read more

Summary

BChE and AChE have also been implicated in regulatioonf

In vertebratestwo related eserine-sensitiveenzymes, acetyl- proliferation incertaintumor cells [16], where BCHE and cholinesterase (AChE, EC 3.1.1.7)l and butyrylcholinesterase ACHE genes appear to have co-amplified. Screening of Genomic Libraries and Nomenclature of Exon 1-The sequence of the 5”region of human BCHE was determined for clone P117, a genomic clone which had been isolated and mapped by Arpagaus et al [21]. Arpagaus et al [21] tentatively identifiedexon 1in the human BCHE gene based on the fact that 120 nucleotides of exon 1 were present in cDNA clones [22]. We know that exon 1of human BCHE contains 149 nucleotides. The present report usetshe nomenclature of Arpagaus et al [21]for exon 1, which turns out to be correct, as shown below. As there is only one BCHE gene [21, 23,24,25] located on human chromosome 3q26, the older nomenclature which assumedtwo BCHE genes is no longer valid

BLEl terminal amino acid of maturehuman
Human and RabbitBCHE Promoters i
Human and RabbiBt CHE Promoters
CGCGAGCTTTGTCAGTAACAGTGAlTGTT CAGTGCAGTCCAATTTA
DISCUSSION
Transcription start
KY YMIFTP CKLCHLCCRESE
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call