Abstract
Prolectin, a previously undescribed glycan-binding receptor, has been identified by re-screening of the human genome for genes encoding proteins containing potential C-type carbohydrate-recognition domains. Glycan array analysis revealed that the carbohydrate-recognition domain in the extracellular domain of the receptor binds glycans with terminal α-linked mannose or fucose residues. Prolectin expressed in fibroblasts is found at the cell surface, but unlike many glycan-binding receptors it does not mediate endocytosis of a neoglycoprotein ligand. However, compared with other known glycan-binding receptors, the receptor contains an unusually large intracellular domain that consists of multiple sequence motifs, including phosphorylated tyrosine residues, that allow it to interact with signaling molecules such as Grb2. Immunohistochemistry has been used to demonstrate that prolectin is expressed on a specialized population of proliferating B cells in germinal centers. Thus, this novel receptor has the potential to function in carbohydrate-mediated communication between cells in the germinal center.
Highlights
The fact that prolectin does not display endocytic activity is consistent with its expression in B cells rather than macrophages or dendritic cells
This pattern of expression and lack of endocytic activity makes it unlikely that prolectin functions as a primary recognition receptor in the innate immune response, a role that is commonly ascribed to DC-SIGN, langerin, the mannose receptor, and other receptors that contain C-type CRDs (1, 26 –28)
In contrast to the selectin cell adhesion molecules, prolectin bears multiple signaling motifs in the cytoplasmic domain, so that it can interact directly with signaling pathways within lymphocytes, it may have a role in cell adhesion
Summary
Prolectin Cloning, Expression, and Purification—The full-length cDNA was amplified from a spleen cDNA library (Clontech) using 40 cycles of PCR with Advantage 2 polymerase mix from Takara and forward primer CCCTGGCTGCCACTTGTCAGGTTC and reverse primer GGGCTTCAACAGGAACATTTCCGC (Invitrogen). The amplified cDNA was isolated by gel electrophoresis and cloned into vector pCRII-TOPO (Invitrogen). The portion of the cDNA encoding the extracellular domain of prolectin was inserted into the expression vector T5T and expressed in Escherichia coli strain BL21(DE3) following the procedure used for DC-SIGN [7]. 594 goat anti-mouse IgG (Invitrogen) and mounted using Vectashield mounting medium with 4Ј,6-diamidino-2-phenylindole (Vector Laboratories). Sections were incubated with biotinylated goat anti-rabbit IgG or anti-mouse IgG (Vector Laboratories), followed by quenching of endogenous peroxidase by 15-min incubation in 3% H2O2 in phosphate-buffered saline. The predicted protein from this interpretation of the CD68, clone KP1 (1:40), mouse anti-CD21 (1:33), and negative genome data (UniProtKB/Swiss-Prot accession number control mouse IgG1 (all Dako); affinity-purified rabbit anti-prolec- Q6ZS10) lacks the C-terminal portion of the CRD. The average KI for ␣Me-Man was 9.9 Ϯ 1.2 mM
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
