Production of Human Albumin in Pigs Through CRISPR/Cas9-Mediated Knockin of Human cDNA into Swine Albumin Locus in the Zygotes.

Chen Ding,Hong Wei,Xiaoyang Zhou,Lei Song,Xingxu Huang,Pumin Zhang,Jianqiao Liu,Jun Qin,Weihua Wang,Jin Peng,Yong Wang,Junyi Jiang,Liping Liu,Lulu Wang

doi:10.1038/srep16705

Abstract

Precise genome modification in large domesticated animals is desirable under many circumstances. In the past it is only possible through lengthy and burdensome cloning procedures. Here we attempted to achieve that goal through the use of the newest genome-modifying tool CRISPR/Cas9. We set out to knockin human albumin cDNA into pig Alb locus for the production of recombinant human serum albumin (rHSA). HSA is a widely used human blood product and is in high demand. We show that homologous recombination can occur highly efficiently in swine zygotes. All 16 piglets born from the manipulated zygotes carry the expected knockin allele and we demonstrated the presence of human albumin in the blood of these piglets. Furthermore, the knockin allele was successfully transmitted through germline. This success in precision genomic engineering is expected to spur exploration of pigs and other large domesticated animals to be used as bioreactors for the production of biomedical products or creation of livestock strains with more desirable traits.

Highlights

Human serum albumin (HSA) is the most abundant plasma protein that plays critical homeostatic functions in human physiology including maintenance of plasma oncotic pressure, regulating body fluids distribution, transportation of small molecules, etc[1]
Signal sequence (2368 bp total) into pig Alb locus immediately downstream the starting codon, we expect human ALB to be expressed under pig endogenous albumin transcriptional control and at the same time block the expression of pig endogenous albumin (Fig. 1a)
Even there were off-target editing, the edited loci are unlikely to be problematic for our purpose of producing recombinant human serum albumin (rHSA), as long as they do not interfere with the welfare of these transgenic pigs

Summary

AAGCCTTTGGCACAATGAAGTGGGTGACTTTTATTTCCCTTCTCTTTCTCTTC gRNA

We designed an sgRNA targeting the starting codon region (immediately 5′ of and including ATG) and generated a targeting fragment (donor for homologous recombination) with the insert flanked by 1 kb homology sequences on both sides (Fig. 1a). Since the 5′ homology sequence used in the donor runs up to the starting codon, it contains the sgRNA sequence and can be targeted by the sgRNA as donor or the knockin allele after homologous recombination. We cloned and sequenced all of the DNA fragments amplified They were the expected homologous recombination products (Fig. S1). Primers e and f (contained within the insert) (Fig. 1a) should amplify a 705 bp fragment from the wildtype locus and a 3085 bp fragment from the knockin allele. Editing on the wildtype allele did happen because the size of the amplified fragments differed from the predicted 705 bp in some piglets (Fig. 1b).

ADFTEISK ADFAAEVDSFKTEISK

Huamn ALB

Methods

Additional Information