Probing GATA factor function in mouse Leydig cells via testicular injection of adenoviral vectors.

Gervette M Penny,Merja Häkkinen,Rebecca B Cochran,David B Wilson,Anja Schrade,Jorma Toppari,Marjut Pihlajoki,Antti Kyrönlahti,Markku Heikinheimo

doi:10.1530/rep-17-0311

Abstract

Testicular Leydig cells produce androgens essential for proper male reproductive development and fertility. Here, we describe a new Leydig cell ablation model based on Cre/Lox recombination of mouse Gata4 and Gata6, two genes implicated in the transcriptional regulation of steroidogenesis. The testicular interstitium of adult Gata4flox/flox ; Gata6flox/flox mice was injected with adenoviral vectors encoding Cre + GFP (Ad-Cre-IRES-GFP) or GFP alone (Ad-GFP). The vectors efficiently and selectively transduced Leydig cells, as evidenced by GFP reporter expression. Three days after Ad-Cre-IRES-GFP injection, expression of androgen biosynthetic genes (Hsd3b1, Cyp17a1 and Hsd17b3) was reduced, whereas expression of another Leydig cell marker, Insl3, was unchanged. Six days after Ad-Cre-IRES-GFP treatment, the testicular interstitium was devoid of Leydig cells, and there was a concomitant loss of all Leydig cell markers. Chromatin condensation, nuclear fragmentation, mitochondrial swelling, and other ultrastructural changes were evident in the degenerating Leydig cells. Liquid chromatography-tandem mass spectrometry demonstrated reduced levels of androstenedione and testosterone in testes from mice injected with Ad-Cre-IRES-GFP. Late effects of treatment included testicular atrophy, infertility and the accumulation of lymphoid cells in the testicular interstitium. We conclude that adenoviral-mediated gene delivery is an expeditious way to probe Leydig cell function in vivo Our findings reinforce the notion that GATA factors are key regulators of steroidogenesis and testicular somatic cell survival.Free Finnish abstract: A Finnish translation of this abstract is freely available at http://www.reproduction-online.org/content/154/4/455/suppl/DC2.

Highlights

Testicular Leydig cells are essential for proper male phenotypic differentiation and fertility (Teerds & Huhtaniemi 2015)
The testes of adult Gata4flox/flox; Gata6flox/flox mice were injected with replication incompetent adenoviral vectors encoding Cre + green fluorescent protein (GFP) (Ad-Cre-IRES-GFP) or GFP alone (Ad-GFP) (Fig. 1A)
GATA4 staining was preserved in Sertoli cells of mice treated with Ad-Cre-IRES-GFP, underscoring the notion that adenovirus injected into the testicular interstitium selectively infects Leydig cells

Summary

Introduction

Testicular Leydig cells are essential for proper male phenotypic differentiation and fertility (Teerds & Huhtaniemi 2015). Adult Leydig cells, which arise in the prepubertal period, secrete androgens essential for sexual maturation and spermatogenesis (Teerds & Huhtaniemi 2015). Conditional targeting of Gata in the adrenogonadal primordium and fetal/adult Leydig cells using Sf1-Cre produces undervirilized mice with small testes that lack mature sperm (Manuylov et al 2011). Simultaneous deletion of both Gata and Gata using Sf1-cre results in a more severe testicular phenotype marked by a paucity of Leydig cells, reduced testosterone production and the accumulation of adrenal-like cells in the interstitium (Padua et al 2015). Our results show that adenoviral-mediated gene delivery is an expeditious and selective means of probing Leydig cell function in vivo

Materials and methods

F: GCGTGACATCAAAGAGAAGC R: AGGATTCCATACCCAAGAAGG F: GCTCACTGGCATGGCCTTCCGTG R

Results

Discussion