Abstract

Fowl adenovirus serotype 4 (FAdV-4) is the pathogenic agent of hydropericardium hepatitis syndrome (HHS) in chickens and ducks, which has caused huge economic losses for the Chinese poultry industry since 2015. In order to objectively determine the prevalence and co-infection status of the virus in Shandong province in China, we analyzed a total of 679 clinical cases of chickens and ducks from 36 farms in the province. The results showed that the FAdV-4 infection rate was 65.2% (443/679), and the rate in breeder ducks was almost two-fold higher than that in breeder chickens (68.57% vs. 34.30%). Notably, co-infection by H9N2 avian influenza virus, infectious bursal disease virus, and/or chicken infectious anemia virus was very common in the 443 FAdV-4-positive cases. Furthermore, phylogenetic analysis of the hexon genes of four Shandong FAdV-4 isolates revealed that these strains clustered into Indian reference strains, indicating that the Shandong FAdV-4 strains might have originated in India. These findings provide the first data on the prevalence and co-infection status of FAdV-4 in Shandong province, which may serve as a foundation for the prevention of FAdV-4 in the field.

Highlights

  • Fowl adenoviruses (FAdVs) are members of the Aviadenovirus genus, Adenoviridae family

  • FAdV-1 can induce gizzard erosion in chickens [3,4,5,6,7,8,9,10,11], inclusion body hepatitis (IBH) in chickens is often associated with FAdV-2

  • Fowl adenovirus serotype 4 (FAdV-4) is the causative agent of hydropericardium hepatitis syndrome (HHS) and IBH in chickens and ducks [13,14], and its diseases have caused severe economic losses in the global poultry industry for more than 30 years [15]

Read more

Summary

Introduction

Fowl adenoviruses (FAdVs) are members of the Aviadenovirus genus, Adenoviridae family. FAdV-4 is the causative agent of hydropericardium hepatitis syndrome (HHS) and IBH in chickens and ducks [13,14], and its diseases have caused severe economic losses in the global poultry industry for more than 30 years [15]. FAdV-4 can clearly cause HHS on its own in chickens and ducks [22,23,24,25], both the extent of the FAdV-4 infection and degree of co-infection in the area remain unclear. To better understand the prevalence of FAdV-4 and the incidence of co-infection by immunosuppressive viruses, an epidemiological survey of FAdV-4 infection in chickens and ducks with HHS in the province was conducted

Sample Collection and Treatment
F: AATGAACGCTCTCCAAGAAG
Phylogenetic Analysis
Data Analysis
Epidemiology of FAdV-4 in HHS
FAdV-4 Co-Infection Rate
Sequencing and Phylogenetic Analysis
Discussion

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.