Abstract

With the increasing immunological studies on camels due to the advantage of their single-chain antibodies for humanizations, it is demanding to develop an easy-to-handle evaluation method of their humoral immune response before proceeding with immunization of foreign antigens that may be toxic to camels. In this study, we quantitatively determined the expression levels of T-helper 2 (Th2) cytokines in peripheral blood lymphocytes obtained from Bactrian camels by real-time PCR. The recorded kinetic profiles resulting from the immunization of ovalbumin (OVA) indicated that after immunization, Th2 cytokines including interleukin (IL) families such as IL-4, IL-10, and IL-13 in the camels were up-regulated by a factor of 1.78, 3.15, and 1.22, respectively, which was validated by traditional enzyme-linked immunosorbent assay (ELISA) methods. Unlike ELISA which requires specific enzyme-labeled antibodies, this established method based on the minimal amount of blood samples holds an advantage in the preliminary evaluation of camel humoral immune response with desirable precision, which is meaningful for biomedical explorations of camel-derived antibodies.

Highlights

  • Chinese Bactrian camels belong to the Camelidae family that is historically evolved to adapt to harsh living environment conditions[1]

  • Since generating heavychain only antibody (HcAb) is closely related to humoral immune responses of camel and the lack of commercial enzyme-labeled antibody, we set out to develop a convenient and accurate method in this study to evaluate the immune efficacy of Bactrian camels by monitoring the expression level of T-helper 2 (Th2) cytokines with real-time PCR assay

  • The goal of such preevaluation before the production of HcAb in camels will serve a complementary method for those laboratories without specific antibodies to evaluate the immune response, which is meaningful for the biotechnical development of unique Bactrian camels in middle Asia

Read more

Summary

Introduction

Chinese Bactrian camels belong to the Camelidae family that is historically evolved to adapt to harsh living environment conditions[1]. Due to the high economic costs as well as the huge size of Bactrian camels, it is thereby urgent to develop an easy-to-handle evaluation method to prejudge the immune response before the antibody production. Since generating HcAb is closely related to humoral immune responses of camel and the lack of commercial enzyme-labeled antibody, we set out to develop a convenient and accurate method in this study to evaluate the immune efficacy of Bactrian camels by monitoring the expression level of Th2 cytokines with real-time PCR assay. The correlation between the two methods was judged by the regression analysis The goal of such preevaluation before the production of HcAb in camels will serve a complementary method for those laboratories without specific antibodies to evaluate the immune response, which is meaningful for the biotechnical development of unique Bactrian camels in middle Asia

Materials and methods
F: CCCTGGTCTGCTTACTGGTT R: TTCCTGTCAAGTCCGCTCA F: TCGGAGATGATCCAGTTTTACC R
Results
Discussion
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call