Abstract

To our knowledge, there was no record of Vibrio cholerae in Haiti until the 2010 post earthquake outbreak. This study describes the analysis of 301 stool samples from 117 infants in Port-au-Prince, Haiti, who participated in a pediatric nutrition study between July 2008 and October 2009. Nine samples were identified positive with both SYBR Green and Taqman-MGB probe based molecular assays targeting V. cholerae hlyA and toxR, respectively (Ct = 33-40), but none were O1 or O139. Our results from multiple molecular assays demonstrate the presence of non-O1/O139 V. cholerae DNA in stools collected from nine asymptomatic Haitian infants two years prior to the 2010 earthquake.

Highlights

  • IntroductionDespite the presence of epidemic cholera in the Caribbean throughout the 1800 and 1900s, Haiti was unaffected by cholera from 1960 until several months after the devastating January 12th 2010 earthquake

  • To our knowledge, there was no record of Vibrio cholerae in Haiti until the 2010 post earthquake outbreak

  • Despite the presence of epidemic cholera in the Caribbean throughout the 1800 and 1900s, Haiti was unaffected by cholera from 1960 until several months after the devastating January 12th 2010 earthquake

Read more

Summary

Introduction

Despite the presence of epidemic cholera in the Caribbean throughout the 1800 and 1900s, Haiti was unaffected by cholera from 1960 until several months after the devastating January 12th 2010 earthquake. The cholera epidemic has killed thousands of people, and extensive efforts have focused on the etiology of this outbreak [1,2]. A recent article showed that two distinct populations of V. cholerae were detected in Haiti early in the epidemic and proposed that nonO1/O139 strains likely existed prior to the earthquake based on comparative genomic analysis [3]. All the samples tested were collected after the earthquake. Direct evidence of presence of V. cholerae in clinical or environmental samples prior to the earthquake would be valuable

Methodology Specimens
Results and discussion
F: CGACGAAGATCATTGACGAC
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.