Potential New Antibiotic Sites in the Ribosome Revealed by Deleterious Mutations in RNA of the Large Ribosomal Subunit

Aymen Yassin,Alexander S Mankin

doi:10.1074/jbc.m703106200

Abstract

The ribosome is the main target for antibiotics that inhibit protein biosynthesis. Despite the chemical diversity of the known antibiotics that affect functions of the large ribosomal subunit, these drugs act on only a few sites corresponding to some of the known functional centers. We have used a genetic approach for identifying structurally and functionally critical sites in the ribosome that can be used as new antibiotic targets. By using randomly mutagenized rRNA genes, we mapped rRNA sites where nucleotide alterations impair the ribosome function or assembly and lead to a deleterious phenotype. A total of 77 single-point deleterious mutations were mapped in 23 S rRNA and ranked according to the severity of their deleterious phenotypes. Many of the mutations mapped to familiar functional sites that are targeted by known antibiotics. However, a number of mutations were located in previously unexplored regions. The distribution of the mutations in the spatial structure of the ribosome showed a strong bias, with the strongly deleterious mutations being mainly localized at the interface of the large subunit and the mild ones on the solvent side. Five sites where deleterious mutations tend to cluster within discrete rRNA elements were identified as potential new antibiotic targets. One of the sites, the conserved segment of helix 38, was studied in more detail. Although the ability of the mutant 50 S subunits to associate with 30 S subunits was impaired, the lethal effect of mutations in this rRNA element was unrelated to its function as an intersubunit bridge. Instead, mutations in this region had a profound deleterious effect on the ribosome assembly.

Highlights

Introduction of the Mutations into thepLK35 Plasmid—The QuikChange XL site-directed mutagenesis kit (Stratagene) was used to generate selected mutations in the pLK35 plasmid
The aim of this project was to map functionally or structurally critical sites in the large ribosomal subunit that can be used as new antibiotic targets
The underlying principle was to detect sites in rRNA where nucleotide alterations would result in the loss of ribosome activity and would manifest themselves in a form of deleterious phenotype

Summary

EXPERIMENTAL PROCEDURES

Plasmids and Strains—The 10,617-bp plasmid pLK35 [27] carries an Escherichia coli rRNA operon rrnB under the control of the ␭ PL promoter and the ampicillin resistance gene as a selective marker. The resulting segment-mutant libraries were enriched in clones carrying deleterious mutations by one round of negative selection as described previously [25]. In the resulting “segment-mutant libraries,” only a specific segment of the plasmid-borne rRNA operon carried the mutations. This experimental setup facilitated subsequent mapping and analysis of the mutations. Expression of the plasmid-borne rRNA operon with even mildly deleterious mutations in 23 S rRNA notably inhibited growth of cells in liquid culture. The mutations were engineered in the 23 S rRNA gene in pLK35 by site-directed mutagenesis, and the phenotypes of POP2136 cells transformed with the mutant pLK35 plasmids were tested in liquid culture, by transformation assay. U2898C a Evolutionary conservation data are taken from Ref. 57

CCGGAG G GC GGAUCGGAGGAAGCGCUUGAUGAAUGUG

Findings

DISCUSSION