Possible contribution of endogenous carbon monoxide to the development of allergic rhinitis in guinea pigs

Yu Shaoqing,Zhu Chunsheng,Chen Jianqiu,Li Genhong,Tang Jiangfeng,Chen Yinjian,Zhang Ruxin

doi:10.1186/1476-9255-5-23

Yu Shaoqing, Zhu Chunsheng + Show 5 more

Open Access

https://doi.org/10.1186/1476-9255-5-23

Copy DOI

Abstract

BackgroundThe mechanisms responsible for the development of allergic rhinitis(AR) are not fully understood. The present study was designed to explore the possible roles of carbon monoxide(CO) on the pathogenesis of AR.MethodsAR guinea pig model was established by nasal ovalbumin sensitization. Twenty-four AR guinea pigs were divided into four groups, 6 in each: Saline control group, AR sensitized group, Hemin treated group, and Zinc protoporphyrin (ZnPP) treated group. The frequency of sneezing and nose rubbing was recorded. Leukocyte infiltration in nasal lavage fluid, serum IgE level and plasma CO were measured. Expression of heme oxygenase-1 (HO-1) mRNA in nasal mucosa was determined by real time RT-PCR, and expression of HO-1 protein was detected by immunohistochemistry.ResultsThe frequency of sneezing and nose rubbing, leukocyte infiltration, serum IgE, plasma CO, and HO-1 mRNA levels in sensitized guinea pigs were higher than those of control (P < 0.05). Except for serum IgE level, all above parameters were even higher (P < 0.05) when treated with Hemin, a heme oxygenase-1 inducer; but significantly decreased (P < 0.05) when treated with ZnPP, a heme oxygenase inhibitor. Immunohistochemical results showed that positive staining of HO-1 was present in the lamina of mucosa of sensitized guinea pigs, and there was an increase of HO-1 immunoreactivity with Hemin administration (P < 0.05) and a decrease with ZnPP treatment.ConclusionThe endogenous CO may take part in the inflammation process of AR and is positively correlated with expression of HO-1 in nasal mucosa. Endogenous CO plays a significant role in the pathogenesis of AR.

Highlights

The mechanisms responsible for the development of allergic rhinitis(AR) are not fully understood
Real time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) for heme oxygenase-1 (HO-1) mRNA Expression To determine the expression of the heme oxygenase (HO)-1 gene in nasal mucosa, fluorescent quantitative real time RT-PCR assay was performed
The sequences of the primers (TaKaRa Inc, Japan) specific for HO-1 were performed with sense (GAAGGAGGCCACCAAGGAGG) and antisense (AGGTCACCCAGGTAGCG GGA) primers, with an expected size of the amplified sequence of 370 bp. β-actin was used as control

Summary

Introduction

The mechanisms responsible for the development of allergic rhinitis(AR) are not fully understood. The present study was designed to explore the possible roles of carbon monoxide(CO) on the pathogenesis of AR. Research on the role of the gas signal messenger such as nitric oxide (NO) and carbon monoxide (CO) in allergy medicine is a rapidly emerging field. HO-2 is constitutively expressed in many mammalian cells. HO-3 is a constitutive isoform of HO. Both HO expression and CO level in the airways increase in response to hypoxic challenge and to a wide variety of inflammatory stimuli such as asthma and allergic rhinitis [4], and the expression of HO1, but not HO-2, is upregulated in the nasal mucosa with allergic rhinitis [5]

Methods

Results

Discussion

Conclusion