Porphyrins Promote the Association of GENOMES UNCOUPLED 4 and a Mg-chelatase Subunit with Chloroplast Membranes

Neil D Adhikari,Robert Orler,Joanne Chory,John E Froehlich,Robert M Larkin

doi:10.1074/jbc.m109.025205

Abstract

In plants, chlorophylls and other tetrapyrroles are synthesized from a branched pathway that is located within chloroplasts. GUN4 (GENOMES UNCOUPLED 4) stimulates chlorophyll biosynthesis by activating Mg-chelatase, the enzyme that commits porphyrins to the chlorophyll branch. GUN4 stimulates Mg-chelatase by a mechanism that involves binding the ChlH subunit of Mg-chelatase, as well as a substrate (protoporphyrin IX) and product (Mg-protoporphyrin IX) of Mg-chelatase. We chose to test whether GUN4 might also affect interactions between Mg-chelatase and chloroplast membranes, the site of chlorophyll biosynthesis. To test this idea, we induced chlorophyll precursor levels in purified pea chloroplasts by feeding these chloroplasts with 5-aminolevulinic acid, determined the relative levels of GUN4 and Mg-chelatase subunits in soluble and membrane-containing fractions derived from these chloroplasts, and quantitated Mg-chelatase activity in membranes isolated from these chloroplasts. We also monitored GUN4 levels in the soluble and membrane-containing fractions derived from chloroplasts fed with various porphyrins. Our results indicate that 5-aminolevulinic acid feeding stimulates Mg-chelatase activity in chloroplast membranes and that the porphyrin-bound forms of GUN4 and possibly ChlH associate most stably with chloroplast membranes. These findings are consistent with GUN4 stimulating chlorophyll biosynthesis not only by activating Mg-chelatase but also by promoting interactions between ChlH and chloroplast membranes.

Highlights

Chlorophylls are produced from a branched pathway located within plastids that produces heme, siroheme, and phytochromobilin
Because chlorophyll biosynthesis is well conserved among plant species [2, 39], we expected that GUN4 would interact with proteins associated with chloroplast membranes such as ChlH from pea and Arabidopsis
Consistent with these previous reports, we found that protoporphyrin IX (PPIX) and Mg-protoporphyrin IX (Mg-PPIX) levels increased 20 –30-fold when purified chloroplasts were fed aminolevulinic acid (ALA) under these conditions (Fig. 2A) and that these porphyrins accumulated in the membrane-containing pellet fraction (Fig. 2B)

Summary

EXPERIMENTAL PROCEDURES

Construction of Plasmids and Strains—For in vitro transcription/translation experiments, the entire GUN4 open reading frame (ORF) was amplified from bacterial artificial chromosome clone T1G3 (Arabidopsis Biological Resource Center, Ohio State University, Columbus) using CGGGATCCTATCTTCCCCTGACGTGAC, AACTGCAGAAAGACATCAGAAGCTGTAATTTG, and PfuTurbo௡ DNA polymerase (Stratagene, La Jolla CA). Fractions of 2.5 ml containing ChlH ⌬1– 823 were pooled, concentrated using an Amicon Ultra-15 centrifugal filter unit with a nominal molecular weight limit of 30,000 (Millipore), dialyzed against storage buffer (50 mM Tricine-KOH, pH 7.9, 1 mM DTT, 50% glycerol), flash-frozen with liquid N2, and stored in small aliquots at Ϫ80 °C. For anti-ChlD antibody development, ChlD was expressed and purified as described for ChlH ⌬1– 823, except that a cDNA encoding a ChlD ORF that lacks the first 516 residues (ChlD ⌬1–516) was amplified using GCGGGATCCACCCTTAGAGCAGCTGCACCATAC and TCGCGTCGACTCAAGAATTCTTCAGATCAGATAGTGCATCC and ligated into pHIS8-3 using BamHI and SalI Another difference was that after elution from Ni-NTA-agarose and thrombin digestion, ChlD ⌬1–516 was further purified by fractionating on a HiLoadTM 26/60 SuperdexTM 200 prep-grade column equilibrated in buffer G (Tris-HCl, pH 7.9, 500 mM NaCl, 1 mM EDTA, 1 mM DTT, 10% glycerol) at 2 ml/min and at 4 °C. We quantified immunoreactive bands with the VersaDoc 4000 MP and Quantity One software (Bio-Rad)

RESULTS

We determined the KdDPIX and

We found that

DISCUSSION

ME was