Abstract

The genetic structure of 20 populations of Fagus orientalis Lipsky (oriental beech) from the territory of the Crimea and the Caucasus was studied on the basis of microsatellite polymorphism (SSR – simple sequence repeats). The isolation distance test performed in the GenePop program showed a high correlation of genetic differences and the logarithm of geographic distance in geographic coordinates at the 0.91 level. Interpopulation genetic differentiation of Fagus orientalis (Fst) ranged from 0.01 to 0.67. On the basis of the obtained genetic data and analysis of the literature on fossil materials, we present a preliminary reconstruction of the possible pathways for spread and the formation of the modern area of the species in the Crimea and on the Caucasian Isthmus within the Caucasian ecoregion. The earliest separation occurred in the populations of the mountainous Crimea and the Stavropol Upland, which retained the unique features of the genotype of the ancestral form in conditions of island isolation. Apparently, beeches from relict mid-mountain populations in refugia of mesophilic vegetation are close to the ancestral form: Colchis (Avadhara, Abkhazia) in the west and Kakheti (Lagodekhi, Georgia) in the east. The observed similarity at the upper border of the beech belt in different regions of the Caucasian Isthmus indicates a parallelism in the development and formation of high-mountain populations of the species.

Highlights

  • Статус вида восточного бука дискуссионен: ряд зарубежных авторов считает его конспецифичным с европейским лесным буком – Fagus sylvatica L. (Denk et al, 2001; 2002), другие авторы рассматривают как подвид F. sylvatica subsp. orientalis (Lipsky) Greuter et Burdet (Müller et al, 2019)

  • Выделение ДНК производили из сухих листьев Fagus orientalis с использованием наборов для выделения ДНК DiamondDNA Plant kit (ООО «Алтайбиотех», Россия)

  • The structure of natural oriental beech (Fagus orientalis) forests in the Caspian region of Iran and potential for the application of the group selection system Forestry

Read more

Summary

Материалы и методы

Молекулярными исследованиями в 2019 г. были охвачены 22 популяции бука восточного (4 из которых, расположенные сравнительно близко, попарно были объединены в 2 популяции) с постсоветского пространства (рис. 1, табл. 1). Из каждой точки в анализ было вовлечено по 10 образцов. Выделение ДНК производили из сухих листьев Fagus orientalis с использованием наборов для выделения ДНК DiamondDNA Plant kit (ООО «Алтайбиотех», Россия). Пар праймеров, разработанных ранее для Fagus sylvatica и Fagus orientalis (Pastorelli et al, 2003), дающих стабильные продукты амплификации. Также была подобрана температура отжига праймеров с учетом использованных нами реагентов Реакцию амплификации проводили с применением готовой ПЦР смеси БиоМастер HS-Taq ПЦР (Биолабмикс, Россия) в объеме 25 мкл и конечной концентрацией праймеров 400 нМ. Разделение продуктов амплификации проводили с помощью капиллярного электрофореза с использованием автоматической станции QIAxcel Advanced (Qiagen, Германия) и набора реагентов QIAxcel DNA High Resolution Kit в соответствии с инструкцией производителя (программа электрофореза OL 800, время инжекции образца 10 сек.). Таблица 1 Точки сбора образцов Fagus orientalis для молекулярно-генетического анализа

Высота над Географические уровнем моря координаты
Географическая привязка места сбора образцов
ACTGGGACAAAAAAACAAAA GAAGGACCAAGGCACATAAA
Результаты и их обсуждение
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call