Abstract

The blood samples were collected from dairy cows at the same milking stage. The single-strand conformation polymorphism (PCR-SSCP) method was used to analyze for polymorphism at the 5'-flanking region of the hsp70 gene. The mRNA expression levels of HSP70,HSF1, Bcl-2 and Bax-α at different daily-mean-temperature were analyzed by relative quantitative RT- PCR. The DNA content, cell phase and the ratio of apoptosis of lymphocytes in peripheral blood of dairy cattle at different daily-mean- temperature were determined by FCM. The PCR-SSCP products of primer pair 1 showed polymorphisms and could be divided into four genotypes: aa, ab, ac, cc, with the cis-acting element (CCAAT box) included. Mutations in the hsp70 5'-flanking region (468-752 bp) had different effects on mRNA expression of HSP70, HSF1, Bcl-2 and Bax-α. The ac genotypic cows showed higher expressions of HSP70mRNA, HSF1mRNA and Bcl-2mRNA/Bax-αmRNA and lower ratio of apoptosis. These mutation sites can be used as molecular genetic markers to assist selection for anti-heat stress cows. (Asian-Aust. J. Anim. Sci. 2005. Vol 18, No. 5 : 734-740)

Highlights

  • Cows of apoptosis induced by the heat shock response is still suffer heat shock when the temperature is over 20°C, and unknown

  • Many studies show that the ratio of apoptosis can the milk yield decline significantly

  • A few of reports explored the protein participates in cell apoptosis and Ca2+ and p53 are relationship between genetic polymorphism of some genes thought to be involved in the regulation of the Bax protein and milk yield and quality (Chrenck et al, 2003; Badola et (Yic, 1997; Ross, 1998; Villunger, 2003; Perfettini, 2004). al., 2004)

Read more

Summary

INTRODUCTION

Cows of apoptosis induced by the heat shock response is still suffer heat shock when the temperature is over 20°C, and unknown. Many studies show that the ratio of apoptosis can the milk yield decline significantly A few of reports explored the protein participates in cell apoptosis and Ca2+ and p53 are relationship between genetic polymorphism of some genes thought to be involved in the regulation of the Bax protein and milk yield and quality (Chrenck et al, 2003; Badola et (Yic, 1997; Ross, 1998; Villunger, 2003; Perfettini, 2004). Heat-shock 2mRNA/Bax-αmRNA of the lymphocytes in the peripheral proteins are bound to heat-shock factors (HSFs) within the blood of dairy cattle at different daily-mean-temperatures. Received July 17, 2004; Accepted November 12, 2004 for thermotolerance cows and improve the milk yield in

Sequences of primers
MATERIALS AND METHODS
Genebank accession Amplified gene Sequence of primers
RESULTS
AATGCCCCCATACCTATATTTAAACAAACTAGAGAAGTTTCCAATACCTC Majo

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.