Abstract

Polymerase Chain Reaction (PCR)-based molecular techniques have been used to detect the polymorphism in plants. The utilization of molecular markers plays essential role in germplasm characterization and plant breeding since the information of DNA marker technology can be exchanged between laboratories and should have standard method to be reproducible. The molecular aspect has been commonly linked to DNA isolation protocol and polymorphic molecular marker, thus can be used for molecular research recommendation purposes. The objectives of this study were to evaluate the capability of microsatellite marker of Ebenaceae Family for amplifying Ebony DNA, and to determine the appropriate PCR annealing temperatures. The DNA isolation of Ebony leaves from Experimental Forest of Hasanuddin University Provenance was carried out using Genomic DNA Mini Kit (Plant) Geneaid protocol. Nine of seventeen selected primers from the Genus Diospyros were able to amplify Ebony DNA. Amplification products produced polymorphic bands with different annealing temperatures (ranged from 53 to 56°C). These nine polymorphic primers will be recommended to use for future studies in genetic diversity as well as pollen dispersal pattern analyses.

Highlights

  • Ebony (Diospyros celebica Bakh.) known as “black-wood” is endemic to Indonesia that distributes from Northern Sulawesi (i.e in Minahasa, Bolaang, Mongondo) and Central Sulawesi (i.e in Parigi, Poso, Donggala, Toli-Toli, Kolonedale, Luwuk) to Southern Sulawesi (i.e in Barru, Luwu, Mamuju) (Hartati and Kamboya 2007)

  • Ebony belongs to the Ebenaceae Family and is categorized as vulnerable species

  • Molecular data can be obtained through a molecular marker

Read more

Summary

Introduction

Ebony (Diospyros celebica Bakh.) known as “black-wood” is endemic to Indonesia that distributes from Northern Sulawesi (i.e in Minahasa, Bolaang, Mongondo) and Central Sulawesi (i.e in Parigi, Poso, Donggala, Toli-Toli, Kolonedale, Luwuk) to Southern Sulawesi (i.e in Barru, Luwu, Mamuju) (Hartati and Kamboya 2007). Prevention of Ebony extinction requires the species conservation through breeding program which is supported by genetic-based molecular information. Ease of SSR marker in amplifying and detecting DNA fragments as well as high polymorphism level causing this method capable of analysing genetic diversity with numerous number of DNA samples. SSRs markers are multiallelic and repeatable, their applications are more interesting for analysing genetic diversity among different genotypes (Rao et al, 2011). Another advantage of this method is PCR products can be separated by agarose gel and by acrylamide gel, in particular for allele of a character that has low polymorphic level (Macaulay et al, 2001). As many as 12 leaf samples were harvested from different trees and wrapped in plastic before stored at -20oC until needed for extraction

DNA Isolation and Primer Screening
F: AGTTCTTGCGATGGGATTTG
Result and Discussion
F: TCGGCTTCACCTATGTTG R
Findings
Conclusion
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call