PO-101 P53 core domain activity at low PH

Abstract

IntroductionThe wild-type p53 is a nuclear tumour suppressor whose DNA binding function is critical for protection against cancer. The major role of p53 in normal cells is to induce cell cycle arrest or apoptosis in response cellular stress, particularly DNA damage. The region responsible for DNA interaction is located in its core domain (p53C). The specific DNA binding activity of p53 is crucial for its tumour suppression function. Missense mutations in the p53 gene are the most frequent type of gene-specific alterations in human cancer. These oncogenic mutant forms of p53 are deficient for specific DNA binding.Material and methodsDNA binding affinities of the p53C with either poly(GC) DNA or consensus DNA (5’ TTTCCTAGACATGCCTAATTA 3’) at low pH were monitored by anisotropy and intrinsic fluorescence, circular dichroism (CD), EMSA (Electrophoretic mobility shift assay) and isothermal titration calorimetry (ITC). HSQC and 1D- NMR (Nuclear magnetic resonance) measurements were carried out to observe the effect of pH on p53 structure.Results and discussionsOur results provided evidence that the specificity and stability of p53 protein:DNA complexes are influenced by pH. We describe the interaction of DNA and p53 at several pH (5.0, 5.5, 6.0, 6.5, 7.2) using fluorescence anisotropy. We confirm the formation of p53C:DNA complex under the same conditions by EMSA and ITC. Comparison of 1D and HSQC spectrum indicates structural changes in the presence of DNA when subjected at 7.2 or 6.0 pH. Far-UV CD shows that the secondary structure of p53 is maintained in the presence of specific (consensus) or unspecific (poliGC) DNA sequences in most studied pH, except at 5.0 pH. To verify the stability of p53:DNA complex at 5.0 pH, we use high pressure. This tool promote a greater effect on the p53 in the absence of DNA when compared with effect caused in the protein:DNA complex.ConclusionAltogether, these data support the hypothesis that the activity of p53 is maintained even after the acidification suggesting the pH change may have implications on cancer patology.