Abstract
Controlled alignment of proteins on molecular frameworks requires the development of facile and orthogonal chemical approaches and molecular scaffolds. In this work, protein-PNA conjugates are brought forward as new chemical components allowing efficient assembly and alignment on DNA scaffolds. Site-selective monomeric teal fluorescent protein (mTFP)-peptide nucleic acid (PNA) (mTFP-PNA) conjugation was achieved by covalent linkage of the PNA to the protein through expressed protein ligation (EPL). A DNA beacon, with 6-Fam and Dabcyl at its ends, acts as a framework to create an assembled hetero-FRET system with the mTFP-PNA conjugate. Using fluorescence intensity, frequency domain lifetime measurements, and anisotropy measurements, the system was shown to produce FRET as indicated by decreased donor intensity, decreased donor lifetime, and increased donor anisotropy. Extension of the DNA scaffold allowed for the assembly of multiple mTFP-PNA constructs. Efficient formation of protein dimers and oligomers on the DNA-PNA frameworks could be shown, as visualized via size exclusion chromatography (SEC) and electrophoresis (SDS-PAGE). Assembly of multiple proteins in a row induced homo-FRET for the mTFP-PNA's assembled on the DNA scaffolds. The oligonucleotide framework allows an induced and controllable assembly of proteins by fusing them to PNAs directed to align on DNA scaffolds.
Highlights
Controlled assembly is of great importance in the modulation, localization, and interactions of proteins
Applying Expressed protein ligation (EPL) to fluorescent proteins (FP) to create FP-Peptide nucleic acid (PNA) conjugates (Scheme 1) provides an ideal system for studying controlled protein assembly: (i) it provides precise control over the exact composition and structure of an inducibly assembled system following addition of a DNA template; (ii) it allows fundamental insights into the behavior of proteins in self-assembled architectures to be gained by observing the photophysical behavior of assembled FPs
This study reports a programmable model system allowing precise control over the assembly of proteins directed by the molecular recognition capabilities of PNA-DNA architectures
Summary
Controlled assembly is of great importance in the modulation, localization, and interactions of proteins. C-terminus of mTFP was performed through incubation of loaded proteins with 20 mL elution buffer (Na2HPO4 (23.2 mM), NaH2PO4 (25 mM), NaCl (100 mM), EDTA (0.5 mM), MESNA (400 mM) in ddH2O, pH 7.5) in the dark with slow shaking overnight at room temperature. The ligation solution was 100 μM mTFP in storage buffer (Na2HPO4 (19.3 mM), NaH2PO4 (25 mM), NaCl (50 mM), EDTA 0.1 mM, in ddH2O pH 7), 400 μM PNA1 (ACGTAC) (Advanced peptide Inc., USA), 70 mM. Hybridization of mTFP-PNA to DNA beacon (6FAM5′ACAGCTGCATGGTCAGTGCTGT3′Dabcyl) (The Midland Certified Reagent Company, Inc., USA) was assessed by SEC-HPLC (SRT SEC-150, 5 μm, 4.6 × 300 mm; Chromex Scientific, UK) calibrated with molecular weight protein marker kit 12−200 kDa (Sigma). Varying concentrations of a DNA Beacon: PNA2 (CAGTCA) (Advanced peptide Inc., USA) (0−27 μM) were incubated with 2.5 μM purified mTFP-PNA solution. When frequency domain lifetime measurements are used, the measured phase, φi, and modulation, mi, may be presented in polar coordinates
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
