Abstract
Adherens junctions (AJs) are the primary intercellular junctions in microvessels responsible for endothelial barrier function. Homophilic adhesion of vascular endothelial (VE) cadherin forms AJs, which are stabilized by binding of p120-catenin (p120). p120 dissociation from VE-cadherin results in loss of VE-cadherin homotypic interaction and AJ disassembly; however, the signaling mechanisms regulating p120 dissociation from VE-cadherin are not understood. To address the mechanism of protein kinase C (PKC)-α function in increasing endothelial permeability, we determined the role of PKCα phosphorylation of p120 in mediating disruption of AJ integrity. We showed that PKCα phosphorylation of p120 at serine (S)879 in response to thrombin or lipopolysaccharide challenge reduced p120 binding affinity for VE-cadherin and mediated AJ disassembly secondary to VE-cadherin internalization. In studies in mouse lung vessels, expression of the phosphodeficient S879A-p120 mutant prevented the increase in vascular permeability induced by activation of the thrombin receptor PAR-1. PKCα phosphorylation of p120 at S879 is a critical phospho-switch mediating disassociation of p120 from VE-cadherin that results in AJ disassembly. Therefore, blocking PKCα-mediated p120 phosphorylation represents a novel targeted anti-inflammatory strategy to prevent disruption of vascular endothelial barrier function.
Highlights
Rationale: Adherens junctions (AJs) are the primary intercellular junctions in microvessels responsible for endothelial barrier function
We showed that protein kinase C (PKC)␣ phosphorylation of p120 at serine (S)[879] in response to thrombin or lipopolysaccharide challenge reduced p120 binding affinity for vascular endothelial (VE)-cadherin and mediated AJ disassembly secondary to VE-cadherin internalization
AJs are formed through vascular endothelial (VE)cadherin clustering and homophilic binding of VE-cadherin on adjacent cells in a Ca2ϩ-dependent manner, thereby effectively restricting passage of plasma proteins of radii greater that 3 nm.[1]
Summary
Endothelial cells and media were obtained from Lonza (Basel, Switzerland). Human ␣-thrombin was obtained from Enzyme Research (South Bend, IN) and LPS was from Sigma (St Louis, MO). PAR-1 agonist peptide (TFLLRNPNDK-NH2) was synthesized.[37] PKC␣ siRNA (UAAGGAACCACAAGCAGUAUU) and MM control (UAAGGAGCCACGAGCGGUAUU) siRNA were purchased from Dharmacon (Lafayette, CO). Anti-p120, anti–VE-cadherin, and anti-GAPDH were purchased from Santa Cruz Biotechnologies (Santa Cruz, CA) and anti-PKC␣, anti–p-PKC, and anti–Na-K ATPase from Cell Signaling (Beverly, MA). PS879-p120 was purchased from BD Biosciences (San Jose, CA) and anti-GFP from GeneTex (San Antonio, TX). AlexaFluor 488 and 594 secondary antibodies and ProLong were from InVitrogen (Grand Island, NY). S879A-p120 and WT-p120 cDNA were gifts from Dr Albert Reynolds (Vanderbilt University), and S879D-p120 was generated using the QuikChange site-directed mutagenesis kit from Stratagene (Santa Clara, CA)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
