Abstract
ObjectiveAcinetobacter baumanii is a pathogenic bacterium that is the cause of many nosocomial infections. This study aimed to determine metallo-β-lactamases (MBL) produced by the A. baumanii isolates obtained from clinical samples in Shahrekord, southwest Iran.ResultsA total of 100 A. baumanii were isolated from 250 clinical samples between June 2013 and June 2014. Then, the isolates were identified by biochemical tests, and MBL screening was conducted by the phenotypic tests modified Hodge, EDTA-disk synergy (EDS), combined disk (CD) and AmpC disc after antibiotic sensitivity test. Using PCR technique the bla genes were detected. Eighty-five (85%) isolates were resistant to meropenem and imipenem. Phenotypic tests showed that out of the 100 isolates, 46, 59, 50, 65 and 65 isolates were positive: AmpC disk, CD, EDS, Modified Hodge and E-test MBL respectively. Gene detection by PCR showed that 23 isolates carried the VIM-1 gene and only three isolates carried the IMP-1 gene. The prevalence of metallo-β-lactamases isolates containing A. baumanii is increasing. Furthermore, the coexistence of various carbapenemases is dominantly act as a major problem. Continuous monitoring of the infections related to these bacteria should be considered to plan an alternative and new therapeutic strategies.
Highlights
Acinetobacter baumanii is recognized for human as a pathogenic bacterium that has the potential to acquire antibiotic resistance and significant inherent resistance in latest years
The isolates were identified by biochemical tests, and MBL screening was conducted by the phenotypic tests modified Hodge, EDTA-disk synergy (EDS), combined disk (CD) and AmpC disc after antibiotic sensitivity test
There are a number of MBLs genes such as imipenemase (IMP), Verona integron-encoded metallo-beta-lactamases (VIM), Sno Paolo metallo (SPM), New-Delhi metallo-βlactamase (NDM), German imipenemase (GIM), Kyorin University Hospital imipenemase (KHM), and Australian imipenemase (AIM) [10, 11]
Summary
Eighty-five (85%) samples were resistant to meropenem and imipenem. 43 number of patients (43%) were female. Eighty-five (85%) samples were resistant to meropenem and imipenem. The tracheal samples carried the most bacteria containing the MBLs. Fisher’s exact test showed that the associations between the samples and the presence of bla VIM-1 (p = 0.28) and bla IMP-1 (p = 0.88) were not statistically significant. Resistance to meropenem and imipenem After incubation of the plates containing the meropenem and imipenem discs and E-test strips, the diameters of the inhibition zones were measured and interpreted with reference to the CLSI. E-test with (MIC > 32) indicated that 85 samples of the 100 A. baumanii isolates were resistant to meropenem and imipenem (carbapenem). The results of phenotypic tests for detecting MBLs 46 (46%) cases out of 100 strains were AmpC beta-lactamase producers, and 59 strains positive by CD test, representing MBL production. TGGTTGTATACGTCCCGTCA:F TGTGTGCTGGAGCAAGTCTA R: TAACGGGTGGGGCGTTGTTCCT:F CGCCCGTGCTGTCGCTATGAAA R: TAATGCTTTGATCGGCCTTG:F TGGATTGCACTTCATCTTGG R: Product size 206 bp bp 179 bp 353
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
